
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
emid1
- Ensembl ID:
- ENSDARG00000076119
- ZFIN ID:
- ZDB-GENE-070705-40
- Description:
- Novel protein containing an EMI domain [Source:UniProtKB/TrEMBL;Acc:A5PMT1]
- Human Orthologue:
- EMID1
- Human Description:
- EMI domain containing 1 [Source:HGNC Symbol;Acc:18036]
- Mouse Orthologue:
- Emid1
- Mouse Description:
- EMI domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2155091]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17183 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17183
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114424 | Essential Splice Site | 67 | 211 | None | 9 |
ENSDART00000146872 | Essential Splice Site | 306 | 447 | None | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 26570793)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 24398058 GRCz11 5 24901858 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- NNNNNNNNNNNNGCCCCCTCGCAYGGACCACCAGGYCCAGCTGGAYCAACCGG[T/G]CAGTAAATCAGAATTAAGAGAACATTTTGATTTCATTATTGGTCATGCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: