zgc:110566

Ensembl ID:
ENSDARG00000076106
ZFIN ID:
ZDB-GENE-050522-531
Description:
hypothetical protein LOC553628 [Source:RefSeq peptide;Acc:NP_001019821]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7264 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043148 Nonsense 435 438 6 6
Genomic Location (Zv9):
Chromosome 3 (position 5102671)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4625772
GRCz11 3 4536062
KASP Assay ID:
554-4476.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAAAGGAATCCCAAMCGCTGGGAGCCTGGAGTGTTTAGGAATAAATA[T/A]TGGGACGAGTAAATCCAATCCCTAAACATACTKTAATTGGGCTAATTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link