
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-1f1.2
- Ensembl ID:
- ENSDARG00000076103
- ZFIN ID:
- ZDB-GENE-091113-42
- Human Orthologue:
- GRID2IP
- Human Description:
- glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein [Source:HGNC Symbol;Acc:18464]
- Mouse Orthologue:
- Grid2ip
- Mouse Description:
- glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 Gene [Source:MGI Symbol;Acc:MG
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11690 | Nonsense | Available for shipment | Available now |
sa19978 | Nonsense | Available for shipment | Available now |
sa31317 | Nonsense | Available for shipment | Available now |
sa33131 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33130 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11690
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108948 | Nonsense | 87 | 1200 | 1 | 27 |
ENSDART00000142478 | Nonsense | 82 | 1174 | 1 | 25 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18529929)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18558291 GRCz11 3 18708031 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGACCCTCAAGACTGTGCCGCCCAGCATCGGAGTCGTGTCTAGAATAGAA[C/T]AGGTCAGTTATTCRTCTCTGACTTGCTATTTAATGAAACTGACATGCAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19978
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108948 | Nonsense | 213 | 1200 | 5 | 27 |
ENSDART00000142478 | Nonsense | 202 | 1174 | 4 | 25 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18515949)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18544311 GRCz11 3 18694051 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAGCACAGGCAGCGCTTTGATGAGATGGTCTCTCAGAGTCTGATCAGT[C/T]GATTGAGGGGCCGAAGCTTCAGCGAGCACAGGAACAATCGGCTACGACGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31317
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108948 | Nonsense | 453 | 1200 | 9 | 27 |
ENSDART00000142478 | Nonsense | 442 | 1174 | 8 | 25 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18510492)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18538854 GRCz11 3 18688594 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTGTGGATGTCTTCCCTGTGTTGGATACGCCAGCAAAACAGGTGATCT[G/A]GCAATTTGTTTACCAGCTGTTGACCTATGAGGAGCAAGAACACTGCCAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33131
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108948 | Nonsense | 841 | 1200 | 19 | 27 |
ENSDART00000142478 | Nonsense | 842 | 1174 | 17 | 25 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18506700)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18535062 GRCz11 3 18684802 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGACAATGATTTTATTTTTATATTTCAGATGGAAGAAGACTCTGATTA[T/G]GACAAGCTGAGTGACATGGTGAAATATCTAGACCTGGAGCTTCATTTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33130
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108948 | Essential Splice Site | 1119 | 1200 | 25 | 27 |
ENSDART00000142478 | Essential Splice Site | 1120 | 1174 | 23 | 25 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18501477)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18529839 GRCz11 3 18679579 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCAGAAGATGCCAGCCACTGCTGAGGACCGATTTGCTGTTGTTATGAGT[G/T]TATCCTCTTATCAATATCTAAAATGACTCGATGTAGTGCATTTAAGTTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: