AP1S3 (2 of 2)

Ensembl ID:
ENSDARG00000076073
Description:
adaptor-related protein complex 1, sigma 3 subunit [Source:HGNC Symbol;Acc:18971]
Human Orthologue:
AP1S3
Human Description:
adaptor-related protein complex 1, sigma 3 subunit [Source:HGNC Symbol;Acc:18971]
Mouse Orthologue:
Ap1s3
Mouse Description:
adaptor-related protein complex AP-1, sigma 3 Gene [Source:MGI Symbol;Acc:MGI:1891304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35992 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110352 Essential Splice Site 38 94 2 3
Genomic Location (Zv9):
Chromosome 15 (position 41887366)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43276834
GRCz11 15 43157812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTCTTGCGATTGATGCATTTGGTGTCTGCTTTGATATCTGTGTTGC[A/T]GGTGTGTGAATTAGACATCATTTTTAACTTCGAGAAGGCTTATTTTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link