zgc:153637

Ensembl ID:
ENSDARG00000076068
ZFIN ID:
ZDB-GENE-061027-225
Description:
hypothetical protein LOC768293 [Source:RefSeq peptide;Acc:NP_001070925]
Human Orthologue:
CRTC1
Human Description:
CREB regulated transcription coactivator 1 [Source:HGNC Symbol;Acc:16062]
Mouse Orthologue:
Crtc1
Mouse Description:
CREB regulated transcription coactivator 1 Gene [Source:MGI Symbol;Acc:MGI:2142523]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14561 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113356 Essential Splice Site 341 533 9 13
Genomic Location (Zv9):
Chromosome 2 (position 24364034)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24938901
GRCz11 2 24594552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTCAGCAGCTGTCGCCCACCCTCTCTCCTCCACTCTCTCTAGCACAG[G/A]TAACACTGCACGCAAACCTGRGGGGAAAATATATATTCTACTATTAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link