si:dkeyp-11a1.1

Ensembl ID:
ENSDARG00000076060
ZFIN IDs:
ZDB-GENE-081028-69, ZDB-GENE-090115-1, ZDB-GENE-090115-1
Description:
Diaphanous 2 [Source:UniProtKB/TrEMBL;Acc:A8DR44]
Human Orthologue:
DIAPH2
Human Description:
diaphanous homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:2877]
Mouse Orthologue:
Diap2
Mouse Description:
diaphanous homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1858500]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42431 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35741 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19092 Nonsense Mutation detected in F1 DNA During 2018
sa9480 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103298 Essential Splice Site 184 470 6 15
ENSDART00000147443 Essential Splice Site 173 640 5 16
Genomic Location (Zv9):
Chromosome 14 (position 40796953)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39039725
GRCz11 14 39407723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCGGACTGCTTTTGGATGCGCTGGAGAGGCTACTTGACAAGAAACAG[T/A]AAGTTATACTGGACATTCTGAAGCCGCTGTTTTTAAGCAATTCCCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103298 Essential Splice Site 289 470 9 15
ENSDART00000147443 Essential Splice Site 278 640 8 16
Genomic Location (Zv9):
Chromosome 14 (position 40803489)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39046261
GRCz11 14 39414259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCGATAGTGGAAGGGCTGGAGAACCACGAAGCCCAGCAGCTGCAGG[T/G]CAGTTTGCTGCCCTTTCCAAGTCTAACTAAACTTACACAGCTATATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103298 Nonsense 292 470 10 15
ENSDART00000147443 Nonsense 281 640 9 16
ENSDART00000103298 Nonsense 292 470 10 15
ENSDART00000147443 Nonsense 281 640 9 16
Genomic Location (Zv9):
Chromosome 14 (position 40808585)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39051357
GRCz11 14 39419355
KASP Assay ID:
2260-7826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTGTGTGTGTGTGTGTGTGTGTCTGTGTGTGAAAACAGGTGGCCTG[T/A]ATGCAGCTGATCAATGCCCTCGTTACCTCCCCGGATGATTTAGACTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103298 Nonsense 292 470 10 15
ENSDART00000147443 Nonsense 281 640 9 16
ENSDART00000103298 Nonsense 292 470 10 15
ENSDART00000147443 Nonsense 281 640 9 16
Genomic Location (Zv9):
Chromosome 14 (position 40808585)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 39051357
GRCz11 14 39419355
KASP Assay ID:
2260-7826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNTGNNTGTSTGTGTGTSTGTGTCTGTGTGTGAAAACAGGTGGCCTG[T/A]ATGCAGCTGAWCAATGCCCTCGTTAYCTCCCCGGATGATTTAGACTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link