si:dkey-282h22.6

Ensembl ID:
ENSDARG00000076052
ZFIN ID:
ZDB-GENE-091204-189
Human Orthologue:
SEZ6L2
Human Description:
seizure related 6 homolog (mouse)-like 2 [Source:HGNC Symbol;Acc:30844]
Mouse Orthologue:
Sez6l2
Mouse Description:
seizure related 6 homolog like 2 Gene [Source:MGI Symbol;Acc:MGI:2385295]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7541 Missense Mutation detected in F1 DNA During 2018
sa10464 Nonsense Available for shipment Available now
sa7540 Missense Mutation detected in F1 DNA During 2018
sa26012 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6029 Nonsense Mutation detected in F1 DNA During 2018
sa40018 Nonsense Mutation detected in F1 DNA During 2018
sa12488 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Missense 32 894 2 18
ENSDART00000142594 Missense 32 892 2 19
Genomic Location (Zv9):
Chromosome 3 (position 14868854)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15114460
GRCz11 3 15264260
KASP Assay ID:
554-4011.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTTTTTYCAGGTGCATCTTTAGGGACATCAGATCCTGAAGCTCCTC[C/T]CACCGTGACTTCTAGTCCCCGCCCCCTGGGAGATCTCATCCATGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Nonsense 217 894 5 18
ENSDART00000142594 Nonsense 217 892 5 19
Genomic Location (Zv9):
Chromosome 3 (position 14863305)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15108911
GRCz11 3 15258711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGCAGCACTTGAGGTTTTGGCCAATGAGACGCTGATGAGCGAAGGT[C/T]AGGTGATTCGTAGCACAACCAATCAAGTGCAGATYCATTATAAGWGCCTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Missense 641 894 12 18
ENSDART00000142594 Missense 643 892 12 19
Genomic Location (Zv9):
Chromosome 3 (position 14851538)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15097144
GRCz11 3 15246944
KASP Assay ID:
554-4247.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGTCTCTGGTCAGAGGAAGTGTGTTGACCTATCAGTGTCAGCCGGGTT[A/G]TGATATCGTYGGCTCTGACATCATTACCTGCCAATGGGAYCTCACTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Essential Splice Site 666 894 12 18
ENSDART00000142594 Essential Splice Site 668 892 12 19
Genomic Location (Zv9):
Chromosome 3 (position 14851460)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15097066
GRCz11 3 15246866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCAATGGGACCTCACTTGGAGTAACAGCCCGCCCACCTGTGTGAAAA[G/T]TGAGTTATTTTTAGCTTCTCATGACTGGCTGTGTTGATTAATGGTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Nonsense 734 894 14 18
ENSDART00000142594 Nonsense 736 892 14 19
Genomic Location (Zv9):
Chromosome 3 (position 14846966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15092572
GRCz11 3 15242372
KASP Assay ID:
554-3753.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATAAWCCACCWGTCAAACCGATTCCCTCTTTTTCCTCWCAGTAAAATA[T/A]GATCCATGCCCAAACCCGGGTGTGCCAGACAACGGCTACCAGACTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Nonsense 751 894 14 18
ENSDART00000142594 Nonsense 753 892 14 19
Genomic Location (Zv9):
Chromosome 3 (position 14846915)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15092521
GRCz11 3 15242321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCATGCCCAAACCCGGGTGTGCCAGACAACGGCTACCAGACTCTGTA[C/A]AAGCACAGTTACCAGGCCGGCGAGACACTGCGCTTCTTCTGCTATGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111948 Essential Splice Site 809 894 16 18
ENSDART00000142594 Essential Splice Site 811 892 16 19
Genomic Location (Zv9):
Chromosome 3 (position 14846447)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15092053
GRCz11 3 15241853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTAGYTCTGTCACGTAATGATGTGAATGTTGTTTACTTTGCTCTTTC[A/G]GTTTCTCAGTCATTAGACGCCTCCCATCWGATGCTGAGTGAGAACATTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link