si:dkey-283j8.1

Ensembl ID:
ENSDARG00000076050
ZFIN ID:
ZDB-GENE-081031-12
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8BA98]
Human Orthologue:
FAM70B
Human Description:
family with sequence similarity 70, member B [Source:HGNC Symbol;Acc:28297]
Mouse Orthologue:
Fam70b
Mouse Description:
family with sequence similarity 70, member B Gene [Source:MGI Symbol;Acc:MGI:2685533]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36712 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115111 Essential Splice Site 118 321 4 9
ENSDART00000141162 Essential Splice Site 118 227 4 7
Genomic Location (Zv9):
Chromosome 18 (position 39340663)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41053380
GRCz11 18 41043572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTCCTGTGTCTTCTGATTGATGGCGTTTTCATTCTGCTCAACATTG[T/A]GAGTACCATAAACATTTCAAAGCAGCTTAACAACCAAAATTATTATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link