zgc:163025

Ensembl ID:
ENSDARG00000076045
ZFIN ID:
ZDB-GENE-070424-102
Description:
hypothetical protein LOC100038778 [Source:RefSeq peptide;Acc:NP_001083027]
Human Orthologue:
F7
Human Description:
coagulation factor VII (serum prothrombin conversion accelerator) [Source:HGNC Symbol;Acc:3544]
Mouse Orthologue:
F7
Mouse Description:
coagulation factor VII Gene [Source:MGI Symbol;Acc:MGI:109325]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32569 Nonsense Mutation detected in F1 DNA During 2018
sa15303 Essential Splice Site Available for shipment Available now
sa5652 Nonsense F2 line generated During 2018
sa45061 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109479 Nonsense 123 431 4 9
Genomic Location (Zv9):
Chromosome 1 (position 5625)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 111623
GRCz11 1 111623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTGTGGACCAGATCAACACATACATCTGCATCTGTCCAGTCAACCTC[G/T]AAGGGCGACACTGCGACAAAGGTAACACACAACACAACACAACTACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109479 Essential Splice Site 250 431 8 9
Genomic Location (Zv9):
Chromosome 1 (position 13071)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 117069
GRCz11 1 117069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTACTGCTGTCCACACATATAACCTGTGTCTGTTTGCKGTGGTCCTGC[A/T]GGTGAGCACATCCGCGATAGAGACGAAGGYACGGAGCAGATGAGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5652
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109479 Nonsense 371 431 8 9
Genomic Location (Zv9):
Chromosome 1 (position 13435)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 117433
GRCz11 1 117433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGATCCGGCCTGACCGTCAGCAGGAACATGCTGTGCGCCGGCTTTGCC[G/T]AGGGAGGGCGCGACTCCTGCCAGGGCGACAGTGGTGGTCCKCTGGTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109479 Nonsense 393 431 8 9
Genomic Location (Zv9):
Chromosome 1 (position 13503)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 117501
GRCz11 1 117501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGGCGACAGTGGTGGTCCGCTGGTCACGCGCTACAGAAACACCTG[G/A]TTTCTGACCGGCATCGTCAGCTGGGGGAAAGGCTGCGCTCGCGCAGACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link