
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cacnb3b
- Ensembl ID:
- ENSDARG00000076030
- ZFIN ID:
- ZDB-GENE-090127-1
- Description:
- Voltage-dependent calcium channel beta 3b subunit [Source:UniProtKB/TrEMBL;Acc:A2SZ56]
- Human Orthologue:
- CACNB3
- Human Description:
- calcium channel, voltage-dependent, beta 3 subunit [Source:HGNC Symbol;Acc:1403]
- Mouse Orthologue:
- Cacnb3
- Mouse Description:
- calcium channel, voltage-dependent, beta 3 subunit Gene [Source:MGI Symbol;Acc:MGI:103307]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7508 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7508
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113796 | Missense | 47 | 332 | 2 | 11 |
ENSDART00000115141 | Missense | 89 | 375 | 3 | 12 |
- Genomic Location (Zv9):
- Chromosome 23 (position 27189506)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 27022328 GRCz11 23 26948869 - KASP Assay ID:
- 554-4191.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTGAACATACTGTCTCTTGCTCTACAGAAGTATAATAATGACTGGTGG[A/T]TCGGGAGGCTGGTGAAGGAGGGGGCAGATATTGCCTTCATCCCCAGCCCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: