si:dkey-39f8.1

Ensembl ID:
ENSDARG00000076020
ZFIN ID:
ZDB-GENE-070912-525
Description:
Novel protein similar to human and mouse pappalysin 2 (PAPPA2) [Source:UniProtKB/TrEMBL;Acc:B0UY77]
Human Orthologue:
PAPPA2
Human Description:
pappalysin 2 [Source:HGNC Symbol;Acc:14615]
Mouse Orthologue:
Pappa2
Mouse Description:
pappalysin 2 Gene [Source:MGI Symbol;Acc:MGI:3051647]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17244 Nonsense Available for shipment Available now
sa44537 Nonsense Mutation detected in F1 DNA During 2018
sa32961 Nonsense Mutation detected in F1 DNA During 2018
sa32960 Nonsense Mutation detected in F1 DNA During 2018
sa39870 Nonsense Mutation detected in F1 DNA During 2018
sa25852 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32959 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 424 1731 2 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536 Nonsense 225 841 2 8
ENSDART00000135892   None 348 None 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34817560)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35114270
GRCz11 2 35096727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAGCCACCAACCCCATTCAGAGAGGCAATCTCCGCTCTTGTCCCAAT[G/A]GGCAGATTTCTCAGAAGTTGAGAACCAGTGGGTGCCCTATAAAGATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 602 1731 2 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536 Nonsense 403 841 2 8
ENSDART00000135892   None 348 None 8
ENSDART00000146942   None 103 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34817025)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35113735
GRCz11 2 35096192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGCGGCGGGATGGAGTCTGCAACCCAGAATGCAACAGCATTCACTA[T/A]GATTACGATGATGGTGATTGCTGTGACCCTGAGGTTACAGATGTCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 670 1731 3 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536 Nonsense 471 841 3 8
ENSDART00000135892   None 348 None 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34787295)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35084005
GRCz11 2 35066462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAATAATTCGGCACGTGAGGAGCTGGCTGGAGTTGCCACTTGGCCATG[G/A]GCAAAAGAAGCTCTTACTCACCAAGGTAAGCTGTCCAGTTGCATGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 862 1731 6 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536 Nonsense 663 841 6 8
ENSDART00000135892   None 348 None 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34778021)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35074731
GRCz11 2 35057188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACTGCCAGCTCTGCGATGAGAATGGAGCTCTCCATCAATATGCCCAT[G/T]AGGCCACTTCACCTCACGCTTGTGACTCCACTGGATACTGGACGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 1492 1731 17 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536   None 841 None 8
ENSDART00000135892 Nonsense 120 348 2 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34737736)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35034446
GRCz11 2 35016903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCATGACGTGGGAACTGTTTGCCGCTTCAAATGCAACCCAGGATATTA[T/A]GTCACTGGGACTCTCAACAAAAAGCCCAGAAAGTGAGTATTCGGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Essential Splice Site 1640 1731 20 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536   None 841 None 8
ENSDART00000135892 Essential Splice Site 268 348 5 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34730131)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35026841
GRCz11 2 35009298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCGCTGATACAGTAGAGCACTGGATGGTTCCAACCAAAGTTCAGG[T/G]GAGGTGGAGGAGCCAGTTTGCAAAGTTTGTTTGATATCTTTGGTTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111730 Nonsense 1650 1731 21 23
ENSDART00000135251   None 94 None 2
ENSDART00000135536   None 841 None 8
ENSDART00000135892 Nonsense 278 348 6 8
ENSDART00000146942   None 104 None 2
Genomic Location (Zv9):
Chromosome 2 (position 34727574)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35024284
GRCz11 2 35006741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCTCTCTTCTGTTAAGAGTATTGTCTGCACTGGGATGTTGAAGTG[G/A]TATCCGAATCCGGAGCAGATCCACTGCATTCAGTCCTGTGAGGTGAGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link