si:ch211-197g15.13

Ensembl ID:
ENSDARG00000076001
ZFIN ID:
ZDB-GENE-091204-194
Description:
LOC798876 protein [Source:UniProtKB/TrEMBL;Acc:A8KB45]
Human Orthologue:
PIP5K1C
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, gamma [Source:HGNC Symbol;Acc:8996]
Mouse Orthologue:
Pip5k1c
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma Gene [Source:MGI Symbol;Acc:MGI:1298224]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45766 Nonsense Mutation detected in F1 DNA During 2018
sa24142 Nonsense Available for shipment Available now
sa3152 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa45766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 308 682 7 18
ENSDART00000105443 Nonsense 269 633 6 17
ENSDART00000111931   None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17789647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17540582
GRCz11 22 17565560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGACTCATGCTGGACACAGACACATACAACGCCCTGGTCAAGACCTTA[C/T]AGAGAGACTGTTTGGTAAGTTCTGGACAGGACAAAACATTTGAACCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 636 682 16 18
ENSDART00000105443 Nonsense 587 633 16 17
ENSDART00000111931   None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17774726)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17525661
GRCz11 22 17550639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCGTGGTGGAGTCTGACGGCGGCAGTCAGGCCTCAGGCTGTACAAGT[A/T]GAGCCTCGGTGGACGAGGAGGATGACGTGCCAATCACAGACATTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3152
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060786 Nonsense 675 682 17 18
ENSDART00000105443 Nonsense 626 633 17 17
ENSDART00000111931   None 274 None 7
Genomic Location (Zv9):
Chromosome 22 (position 17768162)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17519097
GRCz11 22 17544075
KASP Assay ID:
554-2472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGGTTTATTCTCCTCTGCATTTCAGCTCAGGGCCTAAAACCCTGCCC[G/T]AGGATGAAGGGGAAAGTGAAACAGTAAGTGTGCATTGTGTCATTSATCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link