ENSDARG00000075985

Ensembl ID:
ENSDARG00000075985
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45133 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111056 Nonsense 1350 1514 3 3
Genomic Location (Zv9):
Chromosome 3 (position 10521227)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 10168487
GRCz11 3 10137798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTGAAGAATTTTAGACAGCAGCTCTCAGAAGAGTTGATCTTCTCT[G/T]AAACAAACTTCAGCGGTGTCTCACATGAGGATGTTAATGATTTCAACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link