si:dkey-268p11.1

Ensembl ID:
ENSDARG00000075972
ZFIN ID:
ZDB-GENE-090312-137
Human Orthologue:
CSRNP2
Human Description:
cysteine-serine-rich nuclear protein 2 [Source:HGNC Symbol;Acc:16006]
Mouse Orthologue:
Csrnp2
Mouse Description:
cysteine-serine-rich nuclear protein 2 Gene [Source:MGI Symbol;Acc:MGI:2386852]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44026 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114308 Essential Splice Site 140 524 2 4
ENSDART00000146180 Essential Splice Site 140 524 3 5
Genomic Location (Zv9):
Chromosome 23 (position 33849851)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33709649
GRCz11 23 33636180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCGTCAACACTTACGGCAAGAAAAGCTCAACGCTCGCAAGCTAAAGG[T/A]TCGTTTTATGCCAGCTTCCCTAGTCCCTACAGGATTCTACCTTTGTGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link