ENSDARG00000075964

Ensembl ID:
ENSDARG00000075964
Human Orthologues:
ARHGEF40, PLEKHG4
Human Descriptions:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 [Source:HGNC Symbol;Ac
Rho guanine nucleotide exchange factor (GEF) 40 [Source:HGNC Symbol;Acc:25516]
Mouse Orthologues:
E130112L23Rik, Plekhg4
Mouse Descriptions:
pleckstrin homology domain containing, family G (with RhoGef domain) member 4 Gene [Source:MGI Symbo
RIKEN cDNA E130112L23 gene Gene [Source:MGI Symbol;Acc:MGI:2685515]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45284 Nonsense Mutation detected in F1 DNA During 2018
sa7074 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Nonsense 875 2484 1 22
Genomic Location (Zv9):
Chromosome 7 (position 36179537)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34453380
GRCz11 7 34724857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTAATTAATACATCACAGCCAGAGACTGAAATGTTATCTTGTGTTT[T/A]GGAAAGGGAGAACTCAGAACAGGTTTCTCCAGCTTATATTGAACTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Essential Splice Site 1372 2484 4 22
Genomic Location (Zv9):
Chromosome 7 (position 36185731)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34459574
GRCz11 7 34731051
KASP Assay ID:
554-4819.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGTTCACCTGTTCCCGCCCTTTTCAAAGCCTTYAACATCCTCCAGG[T/C]AAGAACACCCTGAMAGTATGATTTGYAATAACAAACACGCATGCAGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108473 Nonsense 1430 2484 6 22
Genomic Location (Zv9):
Chromosome 7 (position 36191711)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34465554
GRCz11 7 34737031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGGACGTTTCTCAGCTTCCCACTGAGTTTGAAGGCACTTTCCCTTA[T/G]GCACACAGCAGCTGGGTCAGCTTTAGAATGGTGAGAAAATCACAATCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link