Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-255p13.2
- Ensembl ID:
- ENSDARG00000075962
- ZFIN IDs:
- ZDB-GENE-030131-7134, ZDB-GENE-070912-251
- Description:
- guanine nucleotide exchange factor VAV3 [Source:RefSeq peptide;Acc:NP_001119865]
- Human Orthologue:
- VAV3
- Human Description:
- vav 3 guanine nucleotide exchange factor [Source:HGNC Symbol;Acc:12659]
- Mouse Orthologue:
- Vav3
- Mouse Description:
- vav 3 oncogene Gene [Source:MGI Symbol;Acc:MGI:1888518]
Alleles
There are 4 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa32867 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa45093 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa30592 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa18562 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32867
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110059 | Essential Splice Site | 414 | 822 | 13 | 27 |
| ENSDART00000142828 | None | 241 | None | 10 |
The following transcripts of ENSDARG00000075962 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 15904801)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16415628 GRCz11 2 16084218 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGTGAAGTGCGTTTGGTGTCAAATTTGGACAAGCGCAGACAGGACAGG[T/C]GAGGCTTCAGGCAATAACCTTTACTGCAGGCTTCTCTTGTTTTTTCACTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45093
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110059 | Nonsense | 433 | 822 | 14 | 27 |
| ENSDART00000142828 | None | 241 | None | 10 |
The following transcripts of ENSDARG00000075962 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 15904659)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16415486 GRCz11 2 16084076 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTGTTCGACGCTGCTGTAATCATCTGCAAGAGGCGAGGGGACAACTA[T/A]GAGATGAAGGAAGTGATCGACCTCAGCCATTTCAAGATCACCAATAATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30592
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110059 | Nonsense | 541 | 822 | 17 | 27 |
| ENSDART00000142828 | Nonsense | 48 | 241 | 2 | 10 |
The following transcripts of ENSDARG00000075962 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 15875491)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16386318 GRCz11 2 16054908 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTGTACTCAGGGGGATTTTTAACCAAGGCTACCTTTGTCCTAAATGT[G/T]GAAACGGGGCTCATAAGGGCTGTCTGGGTAAACTGGGAGTCTGTGGAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18562
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110059 | Nonsense | 812 | 822 | 27 | 27 |
| ENSDART00000142828 | None | 241 | None | 10 |
The following transcripts of ENSDARG00000075962 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 15814624)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16325451 GRCz11 2 15994041 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCACTATAGTGTTTTATATTACAGATRTGTTTTATATTACAGGTTGGCTG[G/A]TTTCCTTCAACATATGTGGAAGAGGAGGAGTGAACGGCGCAGGAATTCAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
