si:dkeyp-27c8.3

Ensembl ID:
ENSDARG00000075960
ZFIN ID:
ZDB-GENE-090312-96
Human Orthologue:
CDH24
Human Description:
cadherin 24, type 2 [Source:HGNC Symbol;Acc:14265]
Mouse Orthologue:
Cdh24
Mouse Description:
cadherin-like 24 Gene [Source:MGI Symbol;Acc:MGI:1928330]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24402 Nonsense Available for shipment Available now
sa37780 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24403 Nonsense Available for shipment Available now
sa13405 Nonsense Available for shipment Available now
sa5983 Nonsense Mutation detected in F1 DNA During 2018
sa37781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Nonsense 885 1870 2 13
ENSDART00000141958 Nonsense 88 643 1 10
Genomic Location (Zv9):
Chromosome 23 (position 40929811)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40762665
GRCz11 23 40655569
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGTGCAGGACATCAACGATAATCCACCGCTGTTCCAGAGCGGCCCCTA[C/A]AGCGCCACCGTACCCGAGATGGCCAACATTGGTATTACAAGTCTCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Essential Splice Site 1183 1870 7 13
ENSDART00000141958 Essential Splice Site 386 643 6 10
Genomic Location (Zv9):
Chromosome 23 (position 40981629)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40814483
GRCz11 23 40707387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGAGCAGGAGCAATGGCACAACATTACTGTCATCGCCACACAGAGAG[G/A]TACCAGAGCTCCTCGCCTCCGCTCTTAAAGGGACACGCCGTCAATTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Nonsense 1384 1870 11 13
ENSDART00000141958 Nonsense 587 643 10 10
Genomic Location (Zv9):
Chromosome 23 (position 41005844)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40838698
GRCz11 23 40731602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTTTTATCTGATAGTGGTGACGGCTCTCTCGCTATCATTGCGAAAG[C/T]AAAAACGGGACACTCAGTCTCCTGTGGAAGATGATGAGATCCGGGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Nonsense 1604 1870 13 13
ENSDART00000141958   None 643 None 10
Genomic Location (Zv9):
Chromosome 23 (position 41015857)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40848711
GRCz11 23 40741615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCATCGGCGGGCCACAAACTAGAGTCGTCCCCTCACGGTTTAAATACA[C/T]GAGCCTCCATTTCCACCATCACCACAGACGACTCAACTCCTGTATCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Nonsense 1662 1870 13 13
ENSDART00000141958   None 643 None 10
Genomic Location (Zv9):
Chromosome 23 (position 41016032)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40848886
GRCz11 23 40741790
KASP Assay ID:
554-3840.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGAACGATGGAGGGAACGCTAYTGAGAAATGGTAGAGGAATAGCTT[T/G]AAACACAACCACTCTTCTTTATCCAGAAGCTGCCGCTGCCACTGCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114959 Nonsense 1755 1870 13 13
ENSDART00000141958   None 643 None 10
Genomic Location (Zv9):
Chromosome 23 (position 41016312)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40849166
GRCz11 23 40742070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAACACCGTCTGGCGATGGTGACCTTTGACCCCATGCAGCCGCCGTA[T/A]GACTCGCTGCAGACGTACGGATTGGAGGGTGGCGGCTCACAGGCCACGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link