si:dkey-266f7.9

Ensembl ID:
ENSDARG00000075958
ZFIN ID:
ZDB-GENE-070705-440
Description:
hypothetical protein LOC100006223 [Source:RefSeq peptide;Acc:NP_001121840]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109133 Nonsense 180 299 2 3
ENSDART00000146987 Nonsense 180 299 3 4
Genomic Location (Zv9):
Chromosome 19 (position 8711349)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8169888
GRCz11 19 8088813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGGATCTGCTGTGGCACAGTAGGGAGATGCCCATTATGGGGGAGGCA[C/T]GAGGGAAGCTGATCATCCTGCAGGATTTTCCAGGTCCTGATATGGGCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link