smg6

Ensembl ID:
ENSDARG00000075957
ZFIN ID:
ZDB-GENE-081107-52
Description:
SMG6 homolog nonsense mediated mRNA decay factor (C. elegans)cds [Source:UniProtKB/TrEMBL;Acc:C5J7W9
Human Orthologue:
SMG6
Human Description:
Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) [Source:HGNC Symbol;Acc:17809]
Mouse Orthologue:
Smg6
Mouse Description:
Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2144

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41704 Nonsense Mutation detected in F1 DNA During 2018
sa17851 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108897 Nonsense 448 1381 8 25
ENSDART00000135950 Nonsense 607 1544 2 19
Genomic Location (Zv9):
Chromosome 10 (position 36634532)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35666287
GRCz11 10 35610147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGACGAAACCGTAGGAAGTCCTCCAGTCCGCCAGGGGGAGTTCTTT[C/T]AAAATCAGCAGGCCGCAGCTATGGCGTACTACAAGTTCCAGAATTCGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108897 Essential Splice Site 956 1381 17 25
ENSDART00000135950 Essential Splice Site 1113 1544 11 19
Genomic Location (Zv9):
Chromosome 10 (position 36626815)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35658577
GRCz11 10 35602437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCCTTGTCCAGCGCTGTACTGAACTCCTGAAGGAAACACCTACTGG[T/G]GAGAAAACTACACATTTGCTGAAAYGAAAAAATGTATATACATTAATATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link