
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-232d9.5
- Ensembl ID:
- ENSDARG00000075928
- ZFIN ID:
- ZDB-GENE-070705-126
- Description:
- Novel protein similar to vertebrate human immunodeficiency virus type I enhancer binding protein 2 (
- Human Orthologue:
- HIVEP3
- Human Description:
- human immunodeficiency virus type I enhancer binding protein 3 [Source:HGNC Symbol;Acc:13561]
- Mouse Orthologue:
- Hivep3
- Mouse Description:
- human immunodeficiency virus type I enhancer binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:10658
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45664 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23486 | Nonsense | Available for shipment | Available now |
sa43247 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36801 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45664
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114608 | Nonsense | 304 | 1286 | 2 | 6 |
ENSDART00000142763 | Nonsense | 432 | 1123 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 19 (position 14765693)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 15429297 GRCz11 19 15333659 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCATGTGAGAAATTTCAACATCATTCTCTTAGTATCCCACAAACTGAAT[C/A]AACATCCACTGCTCCTCTTTTGAGAAGTCACTCCATGCCCTCAGATGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23486
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114608 | Nonsense | 354 | 1286 | 2 | 6 |
ENSDART00000142763 | Nonsense | 482 | 1123 | 1 | 1 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 14765544)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 15429148 GRCz11 19 15333510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTTGATGACCCGCAACCAATTCAGAATCGGCGCCATGGAATGCTAAGA[C/T]GACAGCCTGCAATTGAATTGCCAATTGGCGCTGAATTAACAATGGAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43247
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114608 | Nonsense | 425 | 1286 | 2 | 6 |
ENSDART00000142763 | Nonsense | 553 | 1123 | 1 | 1 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 14765331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 15428935 GRCz11 19 15333297 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGATATCAAAAACACAAACAACACTGTTGCACAGTTCATATTTCTCAA[C/T]AATCTGAAATTCCTGTTTATCAAGTAGATGAATCCACAAGAACATTTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36801
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114608 | Nonsense | 1044 | 1286 | 2 | 6 |
ENSDART00000142763 | None | 1123 | None | 1 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 14763474)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 15427078 GRCz11 19 15331440 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGGTGCTTTCTAAACTACATAAAGCCAAATCCATCCATACAGAGTGAA[C/T]AACAAAACTCAGTCTATTCTTCATGGTGTACAAGTACCCGCAATCCAAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: