
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch1073-179p4.3
- Ensembl ID:
- ENSDARG00000075923
- ZFIN ID:
- ZDB-GENE-040914-66
- Description:
- Novel protein similar to vertebrate thioredoxin reductase 2 (TXNRD2) [Source:UniProtKB/TrEMBL;Acc:B8
- Human Orthologue:
- TXNRD2
- Human Description:
- thioredoxin reductase 2 [Source:HGNC Symbol;Acc:18155]
- Mouse Orthologue:
- Txnrd2
- Mouse Description:
- thioredoxin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1347023]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20364 | Essential Splice Site | Available for shipment | Available now |
sa40377 | Essential Splice Site, Splice Site | Mutation detected in F1 DNA | During 2018 |
sa8420 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20364
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110987 | Essential Splice Site | 130 | 503 | 5 | 17 |
ENSDART00000133455 | Essential Splice Site | 143 | 309 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 5 (position 17117591)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 14846245 GRCz11 5 15346462 - KASP Assay ID:
- 2259-5546.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCATGTTAGGTCTCTAAACTGGGGTCACAGAGTTCAACTACAAGACAAG[T/C]AAGTTTAACCATTAAAACAACATGAACATGAATCTTTTATGGTTTACAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40377
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site, Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110987 | Essential Splice Site | 178 | 503 | 7 | 17 |
ENSDART00000133455 | Splice Site | None | 309 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 5 (position 17115797)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 14844451 GRCz11 5 15344668 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACATTCTGTTAGCTACTGGTGGACGGCCAAAGTACCCTACACATGTAA[G/A]TGTGTGTGTGTGTGCGTGCGTGTGCGCGAGCACCAGTGCAGGCGGGCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8420
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110987 | Essential Splice Site | 463 | 503 | None | 17 |
ENSDART00000133455 | None | 309 | None | 11 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 17015823)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 14811691 GRCz11 5 15311908 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGGGCCGAACGCTGGTGAAGTCACACAGGGCTTTGCTTTGGGCTTCCAG[T/C]ACGTTCCRCACRTCTCTGTAAACTTGCACATGATGMTGGGCTGGAATCAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Glaucoma (primary open-angle): Genome-wide association analyses identify three new susceptibility loci for primary angle closure glaucoma. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: