si:dkey-53d10.1

Ensembl ID:
ENSDARG00000075919
ZFIN ID:
ZDB-GENE-081104-422
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYT1]
Human Orthologue:
FAM190A
Human Description:
family with sequence similarity 190, member A [Source:HGNC Symbol;Acc:29349]
Mouse Orthologue:
Fam190a
Mouse Description:
family with sequence similarity 190, member A Gene [Source:MGI Symbol;Acc:MGI:3045354]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7615 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108865   None 514 None 12
ENSDART00000140115 Missense 370 607 2 8
Genomic Location (Zv9):
Chromosome 8 (position 29576060)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28718786
GRCz11 8 28728018
KASP Assay ID:
554-4217.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACRGGAAGATTATCAGGCTTGAGCAAACTGGAGACCAGACCAAGTCAC[C/A]TGAGAAAGCCGCACACAGGTAATGTGTTTTGTTTTTCTATTTTGAATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link