zgc:66472

Ensembl ID:
ENSDARG00000075916
ZFIN ID:
ZDB-GENE-030131-5705
Description:
hypothetical protein LOC327494 [Source:RefSeq peptide;Acc:NP_956106]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16395 Nonsense Available for shipment Available now
sa39666 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109334 Nonsense 471 556 3 6
ENSDART00000134932 Nonsense 496 581 5 8
ENSDART00000138447 Nonsense 471 556 5 8
Genomic Location (Zv9):
Chromosome 1 (position 44376453)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43292769
GRCz11 1 43993933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATCAGAGCCATCAACTGYGTGTGAAAAYGAGAAGRKAACAGATGAT[G/T]AAAAACTTCCCAGTGATGAGTCCGGACTCTAYACTCCACCAAGAAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109334 Nonsense 545 556 6 6
ENSDART00000134932 Nonsense 570 581 8 8
ENSDART00000138447 Nonsense 545 556 8 8
Genomic Location (Zv9):
Chromosome 1 (position 44372050)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43288366
GRCz11 1 43989530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCAAAGTTTCAGAACACGTGGGAACCAGCAGAAAGCTTTCCAGGCTA[T/G]TTGGATGACAAAAACGAAGAGCCAAAGAAAAACTAGAAGGATCAAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link