
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-70k4.1
- Ensembl ID:
- ENSDARG00000075915
- ZFIN ID:
- ZDB-GENE-030131-3788
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JM47]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7127 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21244 | Nonsense | Available for shipment | Available now |
sa41167 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7127
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109367 | Nonsense | 119 | 574 | 3 | 4 |
ENSDART00000147760 | Nonsense | 129 | 176 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 18054288)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 17499176 GRCz11 8 17534888 - KASP Assay ID:
- 554-4484.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAATCTCCTGTTCAAACAKTRAGTGACTGGAGATGGTGCAATGGAAAY[A/T]AAGATGTAAATCCACCTCCKGGTCTGCCAGCTCCATCATTCCTTGTTCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21244
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109367 | Nonsense | 180 | 574 | 3 | 4 |
ENSDART00000147760 | None | 176 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 18054473)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 17499361 GRCz11 8 17535073 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATCAAGAGAAACATGCATCTTCACCTGATGGAGACAGTGTGCCAGTATG[C/A]AGTACACAAACTACTCAGCAGCGCAAACTAGATGATGGAGTCAACTGCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41167
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109367 | Nonsense | 362 | 574 | 3 | 4 |
ENSDART00000147760 | None | 176 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 18055017)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 17499905 GRCz11 8 17535617 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTAGTACTGGGAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTG[G/T]GAACAAAATCTGGAGCAAGTGGATCTGGATTAGTACTGGGAGCAAAATCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: