slc35f3

Ensembl ID:
ENSDARG00000075909
ZFIN ID:
ZDB-GENE-080204-20
Description:
solute carrier family 35, member F3 [Source:RefSeq peptide;Acc:NP_001104675]
Human Orthologue:
SLC35F3
Human Description:
solute carrier family 35, member F3 [Source:HGNC Symbol;Acc:23616]
Mouse Orthologue:
Slc35f3
Mouse Description:
solute carrier family 35, member F3 Gene [Source:MGI Symbol;Acc:MGI:2444426]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42063 Nonsense Mutation detected in F1 DNA During 2018
sa11636 Nonsense Available for shipment Available now
sa15772 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109189 Nonsense 15 249 2 10
ENSDART00000110773 Nonsense 15 249 2 9
ENSDART00000127616 Nonsense 40 494 2 8
Genomic Location (Zv9):
Chromosome 12 (position 32390883)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30611860
GRCz11 12 30726762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGACATGAGTCCGCGCCGCCTGTCAGATATCAGTCCTCAGATCAGA[C/T]AGCTGAAGTCCCTCGTCCTTGATGAAGATCTGAATGAAGAGTTAAAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109189   None 249 7 10
ENSDART00000110773   None 249 6 9
ENSDART00000127616 Nonsense 371 494 6 8
Genomic Location (Zv9):
Chromosome 12 (position 32398134)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30619111
GRCz11 12 30734013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGCTCACWGGGGCAGAGGACTTCATTTCACCTAGAGATTTACCCTG[G/A]TCAAGCATATGTGGCATGTCTGCTTTACTACTRGGTAAGAGGATGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109189   None 249 8 10
ENSDART00000110773   None 249 7 9
ENSDART00000127616 Nonsense 388 494 7 8
Genomic Location (Zv9):
Chromosome 12 (position 32398285)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30619262
GRCz11 12 30734164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATAATAACATTCTTCTTTGGTTGCACTCCTAGTGTTCAACTTCCTGT[T/A]GAATTGTGGTGTTTTGATAACACTTCCTACTCTGATTTCTCTGGGTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link