socs7

Ensembl ID:
ENSDARG00000075903
ZFIN ID:
ZDB-GENE-080204-125
Description:
cDNA, clone cssl:d0666 [Source:UniProtKB/TrEMBL;Acc:B0CLZ4]
Human Orthologue:
CHADL
Human Description:
chondroadherin-like [Source:HGNC Symbol;Acc:25165]
Mouse Orthologue:
Chadl
Mouse Description:
chondroadherin-like Gene [Source:MGI Symbol;Acc:MGI:3036284]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44758 Nonsense Mutation detected in F1 DNA During 2018
sa19037 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111167 Nonsense 174 765 3 7
Genomic Location (Zv9):
Chromosome 12 (position 20098498)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18880342
GRCz11 12 19002216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACACAACCAACTGGTGTACATCCCTAACATGGCGTTCCAGGGTTTG[C/T]AGAACATTAAATGGCTACGTCTCAGCCACAATTTCATCAATTATCTGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111167 Nonsense 651 765 6 7
Genomic Location (Zv9):
Chromosome 12 (position 20087282)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18869126
GRCz11 12 18991000
KASP Assay ID:
2260-5272.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGAACCAGCTCGAGGAGCTGCCTGACTTGAGTCCACTCACAGGACTC[G/T]AGGTCATAAACTTAGCAGAGAATCCACTGCTCTGCGACTGTCCACTGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link