vwa5b2

Ensembl ID:
ENSDARG00000075886
ZFIN ID:
ZDB-GENE-070912-216
Human Orthologue:
VWA5B2
Human Description:
von Willebrand factor A domain containing 5B2 [Source:HGNC Symbol;Acc:25144]
Mouse Orthologue:
Vwa5b2
Mouse Description:
von Willebrand factor A domain containing 5B2 Gene [Source:MGI Symbol;Acc:MGI:2681859]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38355 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa2031 Nonsense F2 line generated During 2018
sa19862 Nonsense Available for shipment Available now
sa720 Nonsense Available for shipment Available now
sa33014 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114163 Splice Site None 1239 None 24
ENSDART00000131592   None 395 None 8
ENSDART00000136127 Essential Splice Site 46 85 1 2
Genomic Location (Zv9):
Chromosome 2 (position 45083066)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 49862274
GRCz11 2 45021565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACAGGTCATCTCACATATGTGAACACTGACCCTGAACCTGTGGAGG[G/A]TAAGAAATCATGCACACGCACACACACGCACACACGCACACACACACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2031
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114163 Nonsense 142 1239 3 24
ENSDART00000131592   None 395 None 8
ENSDART00000136127   None 85 None 2
Genomic Location (Zv9):
Chromosome 2 (position 45077236)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45162737
GRCz11 2 45015735
KASP Assay ID:
554-2567.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAATCGTGTCCGTTGTCATCAGCACTACCCTTGAACTTCCTACACTT[G/T]AAAATGGTGCAATCCGTCTGGTGTACCCGACAGTGCTCACGCCTTTAGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114163   None 1239 None 24
ENSDART00000131592 Nonsense 194 395 4 8
ENSDART00000136127   None 85 None 2
Genomic Location (Zv9):
Chromosome 2 (position 45070301)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45155802
GRCz11 2 45008800
KASP Assay ID:
2259-2588.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTTCCTCATTGACAACAGCAATACAATGACACAGCACAACATCAAC[A/T]AGATCAAGGTTCTGCAGACACTATACAGCACAATGACATGCGTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114163 Nonsense 581 1239 12 24
ENSDART00000131592   None 395 None 8
ENSDART00000136127   None 85 None 2
Genomic Location (Zv9):
Chromosome 2 (position 45059619)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45145120
GRCz11 2 44998118
KASP Assay ID:
554-0628.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATYAGCAGGATTGTAMGTGGGGTGAATCTTCACCTCAAKACCACGACT[T/G]AGGYGATTCTATTAAGCAAGGCACTGAACCCCCCACCGCTCCGAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114163 Essential Splice Site 732 1239 17 24
ENSDART00000131592   None 395 None 8
ENSDART00000136127   None 85 None 2
Genomic Location (Zv9):
Chromosome 2 (position 45053451)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45138952
GRCz11 2 44991950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATATTTTTATATGTAAAACTCACTGGTACTCTGTGCATGTTTCTGT[A/G]GGCGGGGAAGCTTTTGGATGAGTCTCGCCGGAGGCAGAAGGCTTTGGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link