
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
SHPRH
- Ensembl ID:
- ENSDARG00000075884
- Description:
- SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
- Human Orthologue:
- SHPRH
- Human Description:
- SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
- Mouse Orthologue:
- Shprh
- Mouse Description:
- SNF2 histone linker PHD RING helicase Gene [Source:MGI Symbol;Acc:MGI:1917581]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42868 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22999 | Nonsense | Available for shipment | Available now |
sa36315 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42868
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112878 | Nonsense | 328 | 883 | 8 | 21 |
- Genomic Location (Zv9):
- Chromosome 17 (position 7405325)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 7408099 GRCz11 17 7565277 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGAACTCTGAGGTTTCTGAAGCACATCAAAACCTACAGCCTGTTCTT[C/T]AGCACATTAAAGAACAAAGACGCAAGGTAGACGCTCGGTTATTACATTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22999
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112878 | Nonsense | 374 | 883 | 9 | 21 |
- Genomic Location (Zv9):
- Chromosome 17 (position 7407735)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 7410509 GRCz11 17 7567687 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGATGATCTTGTCAGCCGCATTCAAAATGAGCTTACATGCAGTTATAAA[C/T]AACAAGCCAACAAGCTCTCAATGGCAGACAAGTAATCCAGCATCTCATGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36315
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112878 | Essential Splice Site | 825 | 883 | 19 | 21 |
- Genomic Location (Zv9):
- Chromosome 17 (position 7426265)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 7429039 GRCz11 17 7586217 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCCACGAGCTGCAGGCCATAGGAAGAGTGCATCGGATTGGCCAGACCAA[G/A]TAGGAAACAAACCAATTTTCAATCATATGTCCACTTCTATTCATATTGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: