si:dkey-63k7.8

Ensembl ID:
ENSDARG00000075866
ZFIN ID:
ZDB-GENE-070705-485
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYI2]
Human Orthologue:
CDCP2
Human Description:
CUB domain containing protein 2 [Source:HGNC Symbol;Acc:27297]
Mouse Orthologue:
Cdcp2
Mouse Description:
CUB domain containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:3045328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2057 Nonsense F2 line generated During 2018
sa14046 Nonsense Available for shipment Available now
sa32854 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2057
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114609 Nonsense 26 509 1 5
Genomic Location (Zv9):
Chromosome 2 (position 10692307)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11117403
GRCz11 2 10901002
KASP Assay ID:
554-3129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCRAGCAGTGGCAATGTGTCAAGCCCTAATTTTCCAGGCCTGTATCCTTA[T/G]GACACCGATTGCACTTGGCTGATAGTGGTCTCTGAAGGCTCTTCTGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114609 Nonsense 294 509 3 5
Genomic Location (Zv9):
Chromosome 2 (position 10685293)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11110389
GRCz11 2 10893988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAGCTTGAGGATCGGAACASCTTGACCAGCATGTGTGACTATGACT[C/A]GGTGGCYGTGTATGATGGGGACAGCGAGGCAGACAGTGTGCTGGGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114609 Essential Splice Site 348 509 3 5
Genomic Location (Zv9):
Chromosome 2 (position 10685128)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11110224
GRCz11 2 10893823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGACCGGAACTTTGCTTTTAAGGGCTTCACAGCATCCTATTTAGGGG[G/T]TGAGTGCACATTTATCAAACTTTTTTGAAAGTATTTTATACTGATTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link