SORCS3 (1 of 2)

Ensembl ID:
ENSDARG00000075865
Description:
sortilin-related VPS10 domain containing receptor 3 [Source:HGNC Symbol;Acc:16699]
Human Orthologue:
SORCS3
Human Description:
sortilin-related VPS10 domain containing receptor 3 [Source:HGNC Symbol;Acc:16699]
Mouse Orthologue:
Sorcs3
Mouse Description:
sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32759 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32760 Essential Splice Site Available for shipment Available now
sa18560 Nonsense Available for shipment Available now
sa19576 Essential Splice Site Available for shipment Available now
sa13192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 236 1039 2 22
Genomic Location (Zv9):
Chromosome 1 (position 48752260)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47560287
GRCz11 1 48257250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGTATGACTTTCACCTTGGCAGCGTCACAGAGAGCACGCTATGGAGG[T/C]GAGCTAAAGCCACCATTTCTCTCTCTATCTATCTTTCTCTCTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 236 1039 3 22
Genomic Location (Zv9):
Chromosome 1 (position 48800341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47616143
GRCz11 1 48304469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAAAACATCTCCTGAATGGCATATTGAGAGTGTTGCTTCTATTTCC[A/T]GATCCACGGATTATGGCAGCACTTATGAGAGGCTGAATGATAAAGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Nonsense 747 1039 16 22
Genomic Location (Zv9):
Chromosome 1 (position 48928301)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149942.1 7753
GRCz11 1 48424388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGRAATTATTGTATGGTGGGATGGGACAACTCTAGGATCCTGTCTGCT[G/T]ARCCCTGCATATGCAGAGCACATGACTTTGAGTGGTGAGTTAACCAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Essential Splice Site 758 1039 17 22
Genomic Location (Zv9):
Chromosome 1 (position 48942901)
KASP Assay ID:
2259-1049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCCTCTTTTGC[A/T]GTGATTATGGTTTTGAGAGGAGAGGGGATGGAAACTGTCTGCCGGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110573 Nonsense 775 1039 17 22
Genomic Location (Zv9):
Chromosome 1 (position 48942953)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 47747288
GRCz11 1 48438172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTATGGTTTTGAGAGGAGAGGRGATGGAAACTGTCTGCCGGCRTTTT[G/A]GTTCAACCCTTCTATAGTGTCTCGAAGCTGCAGCCAAGGGCAAAACTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link