si:dkey-269p14.1

Ensembl ID:
ENSDARG00000075859
ZFIN ID:
ZDB-GENE-090312-122
Description:
Novel protein similar to vertebrate MCF.2 cell line derived transforming sequence-like (MCF2L) [Sour
Human Orthologue:
MCF2L
Human Description:
MCF.2 cell line derived transforming sequence-like [Source:HGNC Symbol;Acc:14576]
Mouse Orthologue:
Mcf2l
Mouse Description:
mcf.2 transforming sequence-like Gene [Source:MGI Symbol;Acc:MGI:103263]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32745 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9961 Nonsense Available for shipment Available now
sa18705 Nonsense Mutation detected in F1 DNA During 2018
sa31232 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Essential Splice Site 121 1166 4 31
ENSDART00000144821   None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47032386)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45844047
GRCz11 1 46535279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCAAGACAGATGGGCATCAGTGAAGGGGACACTGCTGCGGATCGCGG[T/C]GAGTCCTCCGTGTGTGTGTTTGTGTGTGAAAGAGAGAGAGATGGGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821   None 213 None 7
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821   None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47073771)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45885432
GRCz11 1 46576664
KASP Assay ID:
2259-0994.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGAGAAGTACTGWCAGAACAAACCTCGCTCAGAGTCTTTATGGAGA[C/T]AGTGCTCTGACTGCGCTTTCTTCCAGGTCTTCTTACTTTTTATATGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821   None 213 None 7
ENSDART00000114083 Nonsense 704 1166 19 31
ENSDART00000144821   None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47073771)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45885432
GRCz11 1 46576664
KASP Assay ID:
2259-0994.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGAGAAGTACTGTCAGAACAAACCTCGCTCAGAGTCTTTATGGAGA[C/T]AGTGCTCTGACTGCGCTTTCTTCCAGGTCTTCTTACTTTTTATATGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114083 Essential Splice Site 743 1166 20 31
ENSDART00000144821   None 213 None 7

The following transcripts of ENSDARG00000075859 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 47075579)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45887240
GRCz11 1 46578472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCTGAAACCTGTGCAGAGAATAACCAAATACCAGCTTTTACTAAAG[G/A]TAAACTACACGGTCGCCTCTCACTGATGTAGGTACAGATATATTGCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link