ZNF608

Ensembl ID:
ENSDARG00000075823
Description:
zinc finger protein 608 [Source:HGNC Symbol;Acc:29238]
Human Orthologue:
ZNF608
Human Description:
zinc finger protein 608 [Source:HGNC Symbol;Acc:29238]
Mouse Orthologue:
Zfp608
Mouse Description:
zinc finger protein 608 Gene [Source:MGI Symbol;Acc:MGI:2442338]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41094 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25379 Nonsense Mutation detected in F1 DNA During 2018
sa34266 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Essential Splice Site 355 1348 5 10
Genomic Location (Zv9):
Chromosome 8 (position 74645)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 45804
GRCz11 8 224627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGGGCACGCTTTTGGACTGTACCAAGCATGACTGGGCTCCACCAAG[G/A]TAATGTGCATAACACAAGTCAAAATTATGAGCCCTCCTGTGAAATCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Nonsense 1108 1348 7 10
Genomic Location (Zv9):
Chromosome 8 (position 78563)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49722
GRCz11 8 228545
KASP Assay ID:
554-7377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCCTCTGGGTTTAGGCTTCAGAATCTCAGTCCTGGAGCCACTCTTAT[C/T]AGTCCAAATATGTGAAGCAGCAAAATCACGAGGTCAACAAGATCTCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112756 Nonsense 1169 1348 7 10
Genomic Location (Zv9):
Chromosome 8 (position 78747)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49906
GRCz11 8 228729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGCTGACGGTTCTGAAGAAAACACCCGGGCGGAGGGCGACGAAACAT[C/A]AGGCGAGACGTCTGAAGACTCCGCAAGAACCGCCGCAGCATCACCCCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Erectile dysfunction and prostate cancer treatment: Genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with the development of erectile dysfunction in African-American men after radiotherapy for prostate cancer. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link