wu:fj11d04

Ensembl ID:
ENSDARG00000075819
ZFIN ID:
ZDB-GENE-030131-7368
Human Orthologue:
ARHGEF2
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:682]
Mouse Orthologue:
Arhgef2
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:103264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22746 Nonsense Available for shipment Available now
sa22747 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078306 Nonsense 98 872 3 21
Genomic Location (Zv9):
Chromosome 16 (position 8108745)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6954477
GRCz11 16 6895155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTCATAACCGCTGCCGAGACACATTGGCCAACTGTGCGAAGATGAAA[C/T]AGAAGGTAAGAGACGATGGAGGGATAATTCACTCTTGAGTATAACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078306 Nonsense 569 872 13 21
Genomic Location (Zv9):
Chromosome 16 (position 8133653)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6979385
GRCz11 16 6920063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACGCCTCCGGAGATGTACGAGCTCCACGCTGCCTCCAAAGACGAT[C/T]GAAACACGTGGATGAAAATCATTCAGCAGACAGTGAGCAAGTCAGAACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link