wu:fa99c08

Ensembl ID:
ENSDARG00000075795
ZFIN ID:
ZDB-GENE-030131-9100
Description:
Wu:fa99c08 protein [Source:UniProtKB/TrEMBL;Acc:A4IGG3]
Human Orthologue:
NOL7
Human Description:
nucleolar protein 7, 27kDa [Source:HGNC Symbol;Acc:21040]
Mouse Orthologue:
Nol7
Mouse Description:
nucleolar protein 7 Gene [Source:MGI Symbol;Acc:MGI:1917328]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39859 Nonsense Mutation detected in F1 DNA During 2018
sa19795 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109460 Nonsense 77 216 2 8
Genomic Location (Zv9):
Chromosome 2 (position 31550794)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31849701
GRCz11 2 31832919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTGCTCAGAGAAAAGAACTTGTTGAAGGAGAAGCGAAGAAAAAGG[C/T]AGCAGCTGTTTCAAGAGCAAAAGGTTGGTCGATTCATTCGGTCTTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109460 Essential Splice Site 103 216 3 8
Genomic Location (Zv9):
Chromosome 2 (position 31550568)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31849475
GRCz11 2 31832693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTACTTCCTGAAGACCTTCTAGAGGAATTTGATACAGAACCTCAAAA[G/A]TAAGTTCTCGCCATTAAAAGGGATAGTTCAGTCAAAAATTAAAATTACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link