si:dkey-48j7.2

Ensembl ID:
ENSDARG00000075793
ZFIN ID:
ZDB-GENE-030131-1428
Description:
Novel protein similar to H.sapiens PREX1, phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exc
Human Orthologue:
PREX1
Human Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 [Source:HGNC Symbol;Acc:325
Mouse Orthologue:
Prex1
Mouse Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 Gene [Source:MGI Symbol;Acc

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41214 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21300 Essential Splice Site Available for shipment Available now
sa21299 Nonsense Available for shipment Available now
sa7614 Missense Mutation detected in F1 DNA During 2018
sa34408 Nonsense Mutation detected in F1 DNA During 2018
sa12745 Essential Splice Site Available for shipment Available now
sa41213 Nonsense Mutation detected in F1 DNA During 2018
sa41212 Nonsense Mutation detected in F1 DNA During 2018
sa27208 Nonsense Mutation detected in F1 DNA During 2018
sa17372 Essential Splice Site Available for shipment Available now
sa17713 Essential Splice Site Available for shipment Available now
sa21298 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Essential Splice Site 52 1622 None 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Essential Splice Site 52 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26418680)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25546598
GRCz11 8 25565737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAACACCGAACGGGATTACGTGAGAAACTTGACATTTCTGCAGTCGG[T/C]AAGTGGACTGGGTTTGATCCAAACTTCTCTTAAGTGTTGTAGTTTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Essential Splice Site 115 1622 3 40
ENSDART00000136869 Essential Splice Site None 56 4 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Essential Splice Site 115 777 3 21
Genomic Location (Zv9):
Chromosome 8 (position 26375387)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25503305
GRCz11 8 25522444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTGAACCCCAGGCGCATCATTCTCTCGGACATGTTTTTCTCCAGTTT[G/T]TGAGTCTAAGAGATTGCATTTCAAATCATCTTTGAACTAGTGCTTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 154 1622 5 40
ENSDART00000136869 Nonsense 18 56 6 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Nonsense 154 777 5 21
Genomic Location (Zv9):
Chromosome 8 (position 26368897)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25496815
GRCz11 8 25515954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTAATCAGGTCATGTGTTTTTTTTTTTTTTTTTTTCAGCACCTCATGT[T/A]GTTAGGTGGTAAGAAGAGCACAGATGTTCCTCTTGAAGGGTATCTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Missense 452 1622 11 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Missense 452 777 11 21
Genomic Location (Zv9):
Chromosome 8 (position 26329883)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25457801
GRCz11 8 25476940
KASP Assay ID:
554-4111.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGAGGAGGGAATCAACCTGGGTCAAGCTCTTCTGGAGAACGGCATCA[T/A]CCATCATGGTGAGAGAAGCTTCTACCGTGRTTATTTCGGCCATCCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 557 1622 16 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Nonsense 557 777 16 21
Genomic Location (Zv9):
Chromosome 8 (position 26323273)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25451191
GRCz11 8 25470330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTCAGACCACTAAATTCAATTCTGACTTTGTGTCATTTGCAGTTT[T/A]GGAGAAGAGTGAATTTAAAGATGAGTCACAGTTTTTCCGCTTCTACGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Essential Splice Site 684 1622 18 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Essential Splice Site 684 777 18 21
Genomic Location (Zv9):
Chromosome 8 (position 26316029)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25443947
GRCz11 8 25463086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTATACRCCGCTCACTCAGACTGCTGGTKGCCACCAAGAACAAAGAG[T/C]GAGTCCAAGTTCATGGAAGAAATCAGATACACAGACCTGTTAAAWGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 750 1622 20 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279 Nonsense 750 777 20 21
Genomic Location (Zv9):
Chromosome 8 (position 26312514)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25440432
GRCz11 8 25459571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGAACCAGAGCGGCTATCAGGAAGTCCTGGAGCACTTCAGTGGCTA[T/A]CAGCCTGTTTTGGAGCAGCAAGACACTGTGAGAATCAGCACTGCATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 872 1622 23 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289 Nonsense 71 807 2 18
ENSDART00000141279   None 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26310065)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25437983
GRCz11 8 25457122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATACTGAAAGCTTTTGTGAAGGATGATAGTCTGTTTGTGAAGAGCTG[T/A]CGGCAGCTAATGGCTCTGAATGATAAGGTTGTGACGATGCCACAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 1047 1622 25 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289 Nonsense 246 807 4 18
ENSDART00000141279   None 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26304985)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25432903
GRCz11 8 25452042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTAAAACAGGAAGACACTGAGAGCCAGGACAATTATATCTGCCTCTA[T/G]AACCGCCTGGACATTGCAGTCCGAGAGATGAAGCAATACGTGGCCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Essential Splice Site 1266 1622 31 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289   None 807 None 18
ENSDART00000141279   None 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26295960)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25423878
GRCz11 8 25443017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTATTGTTGGTTGGATTATATTCATGTMTGTTTGTAACTCTGTTGC[A/T]GATGGAAGGAGTCAGCTCTTGCTGGCGCTGCTTAAATGCACGGGTAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Essential Splice Site 1435 1622 35 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289 Essential Splice Site 620 807 13 18
ENSDART00000141279   None 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26285040)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25412958
GRCz11 8 25432097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCACTGTGCAAAGAGTGAATGTAATATGCATTTTCTWAACTTTTATC[A/C]GGGCTGGAGAAGCCAGAAGGTGTGTTGTCTCAGGATTTTGTTACCATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078022 Nonsense 1466 1622 35 40
ENSDART00000136869   None 56 None 7
ENSDART00000138289 Nonsense 651 807 13 18
ENSDART00000141279   None 777 None 21
Genomic Location (Zv9):
Chromosome 8 (position 26284946)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25412864
GRCz11 8 25432003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGAAGAGTTTCAGCAACGCACAAATGCTCTCTCACTGGAGAAGGTC[A/T]AAGGTTATTACCGCAAACTCAGGTAAGGACCTCTCTTTAGTCATGTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link