myo18l2
- Ensembl ID:
- ENSDARG00000075752
- ZFIN ID:
- ZDB-GENE-080425-5
- Human Orthologue:
- MYO18A
- Human Description:
- myosin XVIIIA [Source:HGNC Symbol;Acc:31104]
- Mouse Orthologue:
- Myo18a
- Mouse Description:
- myosin XVIIIA Gene [Source:MGI Symbol;Acc:MGI:2667185]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa14885 |
Nonsense |
Available for shipment |
Available now |
sa21785 |
Essential Splice Site, Missense |
Available for shipment |
Available now |
sa16330 |
Essential Splice Site |
Available for shipment |
Available now |
sa34958 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa12353 |
Nonsense |
Available for shipment |
Available now |
sa41712 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa34957 |
Nonsense |
Available for shipment |
Available now |
sa13591 |
Nonsense |
Available for shipment |
Available now |
sa34956 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa14885
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 10 (position 38405850)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37128865 |
GRCz11 |
10 |
37072623 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGAAGAGTCTGGAGGAAATGAGCGTGAGGAGAGGTTTCTTTCATCTTCAT[C/T]GAAGCAACTCTAAACGGGAGACGAAAGGGAAGCTGGAGATTTCCAGTCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21785
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site, Missense
- Genomic Location (Zv9):
- Chromosome 10 (position 38403179)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37126194 |
GRCz11 |
10 |
37069952 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGAACTGAGCCGCTGCTGGCTGAGGAACACCAAAGGCCCATATCGCGAGG[T/C]CTATGAGGTGAGATGCAAGTTTGTGTCATGGTTGTGATGTGTTTAACTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16330
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 10 (position 38403171)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37126186 |
GRCz11 |
10 |
37069944 |
- KASP Assay ID:
- 2260-3546.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GCCGCTGCTGGCTGAGRMACACCAAAGRCCCATATCGYGAGGTCTATGAG[G/A]TGAGATGCAAGTTTGTGTCATGGTTGTGATGTGTTTAACTAACCAGTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34958
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 10 (position 38355612)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37078627 |
GRCz11 |
10 |
37022385 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGATCTTAGGGGCCATTTACCATCTCGGTGCTGCCGGGGCCACTAAAGG[T/C]AAAGCTACCAGTGTCTAAACTAATACAAATATTTAAATGTAGGAAGAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12353
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 10 (position 38343210)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37066225 |
GRCz11 |
10 |
37009983 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CACTCTTATGCTAATTTATAAATTTGGTCCTTTCAATCAGGAWGCACTGY[T/A]GGACACCATCCGCAGATCCAAAGTTCACTTTGTCCACTGTCTGTTACCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41712
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 10 (position 38343028)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37066043 |
GRCz11 |
10 |
37009801 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGCTCAAATCCACGGCTTTAAACTGCTGGACAGCTTAAGGATTTACAGA[C/T]AAGGTGAGAAAATATGAGAATATCCAATCAAACATGTAGACATTTGATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34957
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 10 (position 38318338)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37041353 |
GRCz11 |
10 |
36985111 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAACTTTGGAAACTCTGTGTTTGTCAGGAGGTGAATGGAGGCTGAAATA[T/G]GAACGCGCCATCAGAGACACAGAATTCACAAAGAAGAAACTCCAGCAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13591
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 10 (position 38304710)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37027725 |
GRCz11 |
10 |
36971483 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGCAGCTCMGTCGTCTGCAGAGAGAGAAGAATGACCTGCAGTCTCGCTTC[G/T]AGGAGGATCAGGAGGACATGAACGAACTCATGAAGAAACACAAAGCTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34956
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 10 (position 38288245)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
10 |
37011260 |
GRCz11 |
10 |
36955018 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGATCATTTGCAGTTCTGCTGTTTTTAACGTGTTTTCTGTCCATCTTA[G/T]ACACCCCAATTCTGCTAATGCAGACGTGAAAGATGTAAAAGAAGGAAAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: