si:dkey-24n17.8

Ensembl ID:
ENSDARG00000075747
ZFIN ID:
ZDB-GENE-091116-62
Human Orthologue:
ZFYVE16
Human Description:
zinc finger, FYVE domain containing 16 [Source:HGNC Symbol;Acc:20756]
Mouse Orthologue:
Zfyve16
Mouse Description:
zinc finger, FYVE domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:2145181]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21637 Nonsense Available for shipment Available now
sa13367 Nonsense Available for shipment Available now
sa45386 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111830 Nonsense 82 1381 2 17
ENSDART00000147918 Nonsense 82 1384 3 18

The following transcripts of ENSDARG00000075747 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3010664)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2956301
GRCz11 10 2983472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTATGGACTTACATCGCAAAGTATTGACTCAAACCAAAAAGATTCCTA[T/A]TCAAATGAATGGCCCCTCACAGGTGTGGACCTCTTGTCGTCCGTTGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111830 Nonsense 383 1381 2 17
ENSDART00000147918 Nonsense 383 1384 3 18

The following transcripts of ENSDARG00000075747 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3011567)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2957204
GRCz11 10 2984375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGAAAGAAACTTCAAAYGCACCTTATCGCCAACGGACAAATTAACTTG[T/A]AGAGATTTGGGTGCAAGCAATCCGTCTCCATCCTATTCAGAAAGTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111830 Essential Splice Site 801 1381 5 17
ENSDART00000147918 Essential Splice Site 804 1384 6 18

The following transcripts of ENSDARG00000075747 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3034293)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2979930
GRCz11 10 3007101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGATCTTCTCAGGAGTCGAGCCCAGTAACGCCAGACCCGCCGGCGG[T/A]GAGACTGCTAAATCCTCTTAACCGATGCTGCAGATAACTGATGATGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link