zgc:165518

Ensembl ID:
ENSDARG00000075737
ZFIN ID:
ZDB-GENE-070720-15
Description:
Zgc:165518 protein [Source:UniProtKB/TrEMBL;Acc:A6H8S7]
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33068 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11732 Essential Splice Site Available for shipment Available now
sa39964 Nonsense Mutation detected in F1 DNA During 2018
sa39963 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17770 Essential Splice Site Available for shipment Available now
sa17689 Essential Splice Site Available for shipment Available now
sa15226 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 47 1454 2 34
ENSDART00000114289 Essential Splice Site 47 1455 2 34
Genomic Location (Zv9):
Chromosome 3 (position 630205)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 139503
GRCz11 3 76885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCCTGCATGGCCACATGTGTGGATCTGACCAAATCTGTTTTCCTGC[A/T]GGCTCTTCATGGTGGCGTTTCCTTCACTGATCGAGTCCGGCTCTGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 680 1454 15 34
ENSDART00000114289 Essential Splice Site 680 1455 15 34
Genomic Location (Zv9):
Chromosome 3 (position 624992)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 134290
GRCz11 3 71672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACCCCGTCGAGCTGTTCCAACAGATCAGGCTTATAACACCTTCAAGG[T/C]AGAATSCTATTTTTAAAGTGGTTCYTGCTTGTTCTTGGTTTTWCATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Nonsense 1156 1454 27 34
ENSDART00000114289 Nonsense 1157 1455 27 34
Genomic Location (Zv9):
Chromosome 3 (position 622369)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 131667
GRCz11 3 69049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGAACACCTATGTCACTGCTCTGCTCGCCTACACCTTCAGTCTGGCT[G/T]GAGAGACCAGCACTCGAGCACAGCTTTTAAATTCCTTGCGAAACACTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 1379 1454 31 34
ENSDART00000114289 Essential Splice Site 1380 1455 31 34
Genomic Location (Zv9):
Chromosome 3 (position 620857)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 130155
GRCz11 3 67537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTGGACATCAAGGTGTTGTCAGGATTCACTGCAGACACCTCACTG[G/A]TTTGTATTCGTTTTGAGGGTGACTTTTTGGGATCTTTGGAACTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 1379 1454 31 34
ENSDART00000114289 Essential Splice Site 1380 1455 31 34
ENSDART00000110602 Essential Splice Site 1379 1454 31 34
ENSDART00000114289 Essential Splice Site 1380 1455 31 34
Genomic Location (Zv9):
Chromosome 3 (position 620856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 130154
GRCz11 3 67536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTGGACATCAARGTGTTGTCAGGATTCACTGCAGACACMTCACTGG[T/C]TTGTATTCGTTTTGAGGGTGACTTTTTGGGATCTTTGRAACTTGCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 1379 1454 31 34
ENSDART00000114289 Essential Splice Site 1380 1455 31 34
ENSDART00000110602 Essential Splice Site 1379 1454 31 34
ENSDART00000114289 Essential Splice Site 1380 1455 31 34
Genomic Location (Zv9):
Chromosome 3 (position 620856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 130154
GRCz11 3 67536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTGGACATCAARGTGTTGTCAGGATTCACTGCAGACACMTCACTGG[T/C]TTGTATTCGTTTTGAGGGTGACTTTTTGGGATCTTTGRAACTTGCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110602 Essential Splice Site 1406 1454 32 34
ENSDART00000114289 Essential Splice Site 1407 1455 32 34
Genomic Location (Zv9):
Chromosome 3 (position 620692)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 129990
GRCz11 3 67372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCARAGGGTGGATACTGAAGGTGATCGTGTGCTTGTCTATCTACAAGAG[G/C]TGAGATRGTWGTTACTTRCACTTAATGATAAATTATGCCATTTTTAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link