si:dkey-242e21.3

Ensembl ID:
ENSDARG00000075723
ZFIN ID:
ZDB-GENE-100922-110

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36219 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32105 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115124 Essential Splice Site 550 717 15 19
ENSDART00000134498 Essential Splice Site 351 518 11 15
Genomic Location (Zv9):
Chromosome 16 (position 43023914)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40407364
GRCz11 16 40357396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAGTAGTATTCATATATAATAGTATTCATATATTCTCTTTTGTCTTC[A/G]GCAGAGGATGTGAATGATTCAGACAGTACGTCTTCTGGCGAGTGCTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115124 Nonsense 652 717 18 19
ENSDART00000134498 Nonsense 453 518 14 15
Genomic Location (Zv9):
Chromosome 16 (position 43020961)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40404411
GRCz11 16 40354443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTTTTTGTAAGGTGAGGAAAGCCCATCGCTTCCTGAGACGTCTATT[C/T]AAAATCCACACTTTGCACAGACGACAGAAAGTACAGACGGTTACAAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link