zdhhc6

Ensembl ID:
ENSDARG00000075721
ZFIN ID:
ZDB-GENE-030131-3189
Human Orthologue:
ZDHHC6
Human Description:
zinc finger, DHHC-type containing 6 [Source:HGNC Symbol;Acc:19160]
Mouse Orthologue:
Zdhhc6
Mouse Description:
zinc finger, DHHC domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914230]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22133 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112386 Essential Splice Site 315 412 7 10
Genomic Location (Zv9):
Chromosome 12 (position 33122864)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31320861
GRCz11 12 31435763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTAGATAGAGCAGCTGAAGCAAAAACATGACAAGCGTCAGAGGAGTG[T/C]GAGTATTGCTGTAACCGCTTTTAATCACTAGAGGGCGTCGTTTAATAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link