wu:fd46c06

Ensembl ID:
ENSDARG00000075719
ZFIN ID:
ZDB-GENE-030131-4645
Description:
complement component 1, s subcomponent-like [Source:RefSeq peptide;Acc:NP_001107921]
Human Orthologue:
C1S
Human Description:
complement component 1, s subcomponent [Source:HGNC Symbol;Acc:1247]
Mouse Orthologues:
C1s, Gm5077
Mouse Descriptions:
complement component 1, s subcomponent Gene [Source:MGI Symbol;Acc:MGI:1355312]
predicted gene 5077 Gene [Source:MGI Symbol;Acc:MGI:3644269]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17822 Essential Splice Site Available for shipment Available now
sa28691 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22881 Nonsense Available for shipment Available now
sa36184 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114864 Essential Splice Site 77 458 3 6
Genomic Location (Zv9):
Chromosome 16 (position 34166028)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31703998
GRCz11 16 31661013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACAATCATTTGAGCWGCAGTAARATGCAGTTTCCATTATTTGCATTC[A/C]GGTTGTRTTTAATAAWAAGGTTCTGTGGAAGTTTTGTGGACAGAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114864 Essential Splice Site 177 458 4 6
Genomic Location (Zv9):
Chromosome 16 (position 34164433)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31702403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCAGTCTCAAGTGCAAATCTGAATTTTATCAATTAGATAAAAAAGG[T/G]AAGATTTGTGGTTTACATGCATTACGTTAATGTAATTCTCAAAAGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114864 Nonsense 296 458 6 6
Genomic Location (Zv9):
Chromosome 16 (position 34163931)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31701901
GRCz11 16 31658887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGTTTTTATGGAAACAGAGAAGATCATAATTCACCCAAATTATAAG[A/T]AGGTTGATAAAGATGGGCGTCAGTCAGACTTTAATAATGATATTGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114864 Nonsense 444 458 6 6
Genomic Location (Zv9):
Chromosome 16 (position 34163487)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31701457
GRCz11 16 31658443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGTCCTAAATGTGCTAAAACAATCACTAAAGGTTACTACACTAAAGTG[C/T]AAAACTACCTGGACTGGATTGAAGAAACTATGGCAAATAATTCATAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link