
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fd46c06
- Ensembl ID:
- ENSDARG00000075719
- ZFIN ID:
- ZDB-GENE-030131-4645
- Description:
- complement component 1, s subcomponent-like [Source:RefSeq peptide;Acc:NP_001107921]
- Human Orthologue:
- C1S
- Human Description:
- complement component 1, s subcomponent [Source:HGNC Symbol;Acc:1247]
- Mouse Orthologues:
- C1s, Gm5077
- Mouse Descriptions:
- complement component 1, s subcomponent Gene [Source:MGI Symbol;Acc:MGI:1355312]
- predicted gene 5077 Gene [Source:MGI Symbol;Acc:MGI:3644269]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17822 | Essential Splice Site | Available for shipment | Available now |
sa28691 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22881 | Nonsense | Available for shipment | Available now |
sa36184 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17822
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114864 | Essential Splice Site | 77 | 458 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 34166028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 31703998 GRCz11 16 31661013 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACACAATCATTTGAGCWGCAGTAARATGCAGTTTCCATTATTTGCATTC[A/C]GGTTGTRTTTAATAAWAAGGTTCTGTGGAAGTTTTGTGGACAGAATTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28691
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114864 | Essential Splice Site | 177 | 458 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 34164433)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 31702403 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAATCAGTCTCAAGTGCAAATCTGAATTTTATCAATTAGATAAAAAAGG[T/G]AAGATTTGTGGTTTACATGCATTACGTTAATGTAATTCTCAAAAGTGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22881
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114864 | Nonsense | 296 | 458 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 34163931)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 31701901 GRCz11 16 31658887 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCAGTTTTTATGGAAACAGAGAAGATCATAATTCACCCAAATTATAAG[A/T]AGGTTGATAAAGATGGGCGTCAGTCAGACTTTAATAATGATATTGCTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36184
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114864 | Nonsense | 444 | 458 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 16 (position 34163487)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 31701457 GRCz11 16 31658443 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGGTCCTAAATGTGCTAAAACAATCACTAAAGGTTACTACACTAAAGTG[C/T]AAAACTACCTGGACTGGATTGAAGAAACTATGGCAAATAATTCATAATGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: