
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rpz5
- Ensembl ID:
- ENSDARG00000075718
- ZFIN ID:
- ZDB-GENE-030131-4678
- Description:
- rapunzel 5 [Source:RefSeq peptide;Acc:NP_001103594]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22941 | Nonsense | Available for shipment | Available now |
sa6448 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa14760 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22941
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105931 | Nonsense | 81 | 393 | 2 | 2 |
ENSDART00000134734 | Nonsense | 81 | 201 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 16 (position 49559110)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 46528139 GRCz11 16 46494855 - KASP Assay ID:
- 2261-0290.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAATTTGAAAAGATCAACCAAAAACTGGAAGGGATTCAAGACGAAATC[G/T]AACAAATTGCTTTGGAGTTGCAGAGGACATCCATGAACAAGCAGAATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6448
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105931 | Nonsense | 332 | 393 | 2 | 2 |
ENSDART00000134734 | None | 201 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 16 (position 49559863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 46528892 GRCz11 16 46495608 - KASP Assay ID:
- 554-4032.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTCTTTCAGCGCTGACCCGAAACCGATTAACAAGAGCGAGATTGTAGAT[C/T]AGATAGAGATGCAGAAGCTGAAGGGCAACATGCAGTCTGTGGCTCAGACS
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14760
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105931 | Nonsense | 387 | 393 | 2 | 2 |
ENSDART00000134734 | None | 201 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 16 (position 49560030)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 46529059 GRCz11 16 46495775 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACAACTTCCAGCCGGAGTRTTTCTAYTTCGCRAGGCACAAGAAGGCATA[C/A]CTKTGCATTCACTCTGAAYAGAWRTGCCAAACTTTRATATCAGTCTCCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: