zgc:165651

Ensembl ID:
ENSDARG00000075700
ZFIN ID:
ZDB-GENE-070719-8
Description:
zinc finger SWIM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001093613]
Human Orthologue:
ZSWIM2
Human Description:
zinc finger, SWIM-type containing 2 [Source:HGNC Symbol;Acc:30990]
Mouse Orthologue:
Zswim2
Mouse Description:
zinc finger, SWIM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1919111]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33825 Nonsense Mutation detected in F1 DNA During 2018
sa20662 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112212 Nonsense 42 589 1 10
Genomic Location (Zv9):
Chromosome 6 (position 11672001)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11525627
GRCz11 6 11761054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCATTTTCATCCTCAAAGAGTACGGGCCGATTGGATTCCTCCTGCAA[G/T]AGGATGGAGAAAGCAAACATTATAAAGTATTCATTTATTCCTTGTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112212 Essential Splice Site 90 589 3 10
Genomic Location (Zv9):
Chromosome 6 (position 11672423)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11526049
GRCz11 6 11761476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTAGGATTTTAATGCGCAAATTTCGGCTGCCAAGAGATCATGAATG[T/A]AAGTAAAAAATTGGAAGTGTCGTTGTAGTTTTTCAATAGATGCCACAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link