si:dkey-73i4.2

Ensembl ID:
ENSDARG00000075694
ZFIN ID:
ZDB-GENE-081105-156
Description:
similar to adenosine A1 receptor [Source:RefSeq peptide;Acc:NP_001122056]
Human Orthologue:
ADORA1
Human Description:
adenosine A1 receptor [Source:HGNC Symbol;Acc:262]
Mouse Orthologue:
Adora1
Mouse Description:
adenosine A1 receptor Gene [Source:MGI Symbol;Acc:MGI:99401]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16792 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112926 Essential Splice Site 114 341 2 2
Genomic Location (Zv9):
Chromosome 8 (position 24976126)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24101944
GRCz11 8 24123183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYAATTCATATTRGCACTAAATGGACTWTTGTTGTGYTCTTGTGTTGCA[G/A]TTATAAGCGAGTCGTCACTCCYAAACGAGCTGGAATTGCAGTGTTCATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link