zgc:175266

Ensembl ID:
ENSDARG00000075688
ZFIN IDs:
ZDB-GENE-030131-387, ZDB-GENE-080219-14
Description:
hypothetical protein LOC571418 [Source:RefSeq peptide;Acc:NP_001107916]
Human Orthologue:
C20orf118
Human Description:
chromosome 20 open reading frame 118 [Source:HGNC Symbol;Acc:16112]
Mouse Orthologue:
Gm1332
Mouse Description:
predicted gene 1332 Gene [Source:MGI Symbol;Acc:MGI:2686178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113851 Nonsense 448 529 8 10
Genomic Location (Zv9):
Chromosome 16 (position 46306568)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42380397
GRCz11 16 43457871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGCTTCATCGTGGTWAAGAAAATYGAGGARTCTGAGGCAAACGAGGAG[C/T]AGCAACCTGAGGAAARCTCAGAGAAGGAGTGGGAGGTACGACCCATGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link