si:ch1073-154c4.1

Ensembl ID:
ENSDARG00000075676
ZFIN ID:
ZDB-GENE-100922-114
Human Orthologue:
FNDC7
Human Description:
fibronectin type III domain containing 7 [Source:HGNC Symbol;Acc:26668]
Mouse Orthologue:
Fndc7
Mouse Description:
fibronectin type III domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2443535]

Alleles

There are 20 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10770 Nonsense Available for shipment Available now
sa29857 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6719 Nonsense Mutation detected in F1 DNA During 2018
sa37591 Nonsense Mutation detected in F1 DNA During 2018
sa37590 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10526 Essential Splice Site Available for shipment Available now
sa39391 Nonsense Mutation detected in F1 DNA During 2018
sa9051 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31077 Nonsense Mutation detected in F1 DNA During 2018
sa3218 Nonsense F2 line generated During 2018
sa24238 Essential Splice Site Available for shipment Available now
sa19309 Nonsense Mutation detected in F1 DNA During 2018
sa37589 Nonsense Mutation detected in F1 DNA During 2018
sa12031 Essential Splice Site Available for shipment Available now
sa24237 Essential Splice Site Available for shipment Available now
sa37588 Nonsense Available for shipment Available now
sa15780 Nonsense Available for shipment Available now
sa8958 Nonsense Mutation detected in F1 DNA During 2018
sa39390 Nonsense Mutation detected in F1 DNA During 2018
sa43903 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 160 4636 3 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1653002)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1621277
GRCz11 23 1630386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCWACCTGTGGACAAGGYTCTAGTCTACAACCTTACCATCAAAAACTG[G/A]AATTCGATAAACACTACACTATATTCRAGCACTGTGTTCAACAACACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 390 4636 5 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1648425)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1616700
GRCz11 23 1625807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCAGTGCAACTCCCCATCCAGTTCAGCGATTCAAATACGAACTG[G/A]TAACAATAAATATATCTTCAAAATCTATACGTGTTTATCATGACTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 409 4636 6 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1647897)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1616172
GRCz11 23 1625279
KASP Assay ID:
554-4739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGYCCACCAAGGAACATGCGCACGTCCACCGACTGTCAGACAGATGTGT[T/A]GACCAGCAGCTGGGAAGGTGCGGATGGAGCCMTACGGTACACAGTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 990 4636 12 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1642777)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1611052
GRCz11 23 1620159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGTGGTAAGAACTACACTGCCATCATCACAGCATCCAATGGAGAGTG[T/A]CAAGGGCCAGGGAGCCAGAGCCGTCCTGTCCAAACAGGTGAGATTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1090 4636 13 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1640316)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1608691
GRCz11 23 1617798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAATCAGTGCCACAGCTTAGCCGGCTCCAACGTCTCTGTGACAACAGG[T/C]AGGGAAACGCATCAGTTTCACCTTGATAGAAAGGCCAAGGGATTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1265 4636 15 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1636441)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1604816
GRCz11 23 1613923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGMCCGCAGTGCTGGAGTWCACCCAGTGCTCCRTTCAGTGTTATCACAG[G/A]TACGTSCACCACACATTCAAAGTTCAGCATCTAGTGATGTGCATTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 1347 4636 16 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1635731)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1604106
GRCz11 23 1613213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCAGTCCATTTCTAGTCACTGCAACAGCAGCTATGCAGCACGCACG[C/T]AGCTACAGACAGGTGAACACGCATACACACACTGTACAAGCATCCTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 1524 4636 18 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1634560)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1602935
GRCz11 23 1612042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCGTGGTTGCAAGAGTCAACCCAGCACACCAGTCAGTCTAYAATCAG[G/A]TCAGCAAACAGGACAAGTAGTAGTWTAGGATTTCTCTTATCATATTGYRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2285 4636 27 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1625136)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1593511
GRCz11 23 1602618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACCACAGAGACCAGCTGCAATATCAGTCTGAGATGTGGCATGAATTA[T/A]AATCTGACAGTAGTACCATTAAGAGATGGCTGCATTGGGGCAAATTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3218
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2452 4636 29 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1624446)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1592821
GRCz11 23 1601928
KASP Assay ID:
554-2709.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACAGACCATCTGCTGCACTGCAAACTCCACTTCCTGTGAGGTCACTT[C/A]AATTCCTTGCGGACAGATGTATGTCCTGACAGTCACTGCTGAGGGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 2571 4636 31 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1621471)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1589846
GRCz11 23 1598953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTTTCCTAATCGCTTGATCTTGATTTGATTCACTTTCTTTATGTCTA[G/A]TACCTTGTGTGCCGGATTTTGTGACTGCTAATGTGATATGCCAATCGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2633 4636 31 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1621285)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1589660
GRCz11 23 1598767
KASP Assay ID:
554-6175.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGCATGAACAACACCTCCTGTACAATTAATGGACTTCCCTGCGGT[C/T]AGACCTACCATATCAGTGTGATAGCATCTGACGGATACTGCGATAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 2982 4636 35 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1617047)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1585422
GRCz11 23 1594529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCATTTCTCAAGAAAATTACTGTAACGTTAGTAATCTAGCCTGCGGA[C/T]AGACATATAAAGTGAGGCTGACAGCAATCAATCATGGATGTCAGGTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 3182 4636 38 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1614571)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1582946
GRCz11 23 1592053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTTACTGGRTTGTGTATCTATTGTGTGTKTGTTTKTTTTYTCTATA[G/A]CCCCATGTGTGCCGTACAACACCAATACCTTTGTGGAATGCCARAATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 3356 4636 39 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1613906)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1582281
GRCz11 23 1591388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATATATGCTGGAGCACAGCCAGCAATGTTTCAGTGCTGCAGACAGG[T/C]TAGGATCCTCTCACACACATGCACAGACACGGTGTCAAAACATGTAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3474 4636 41 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1612653)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1581028
GRCz11 23 1590135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCGGAAGCTCATGTGTCCTGGAATGCAAGCATGGGGGCGATGTACTA[C/A]ACTGTGTACGCCTGGAGCACAACATTCAATTTCATATCCTGTGATAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3624 4636 43 55
ENSDART00000136037 Nonsense 40 213 2 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1609534)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1577909
GRCz11 23 1587016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCGCTCTCTCTTTTCYTCTCTCSCTGTGAACAGTACCCTGTCCACCC[C/T]AGAATGTGCTTTCAAATATGCTCTGCTCTTTAAGTTCTGCCAATGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3693 4636 43 55
ENSDART00000136037 Nonsense 109 213 2 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1609325)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1577700
GRCz11 23 1586807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAWTGTGGCTCCGTTTACAACATCAGTGTGCTTGCCCTTGGTCATCACTG[T/A]AATGTGTCCAAGAGTGCARTCACAACACTGCATTCAGGTRGGCAACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Nonsense 3943 4636 46 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841   None 310 None 5
Genomic Location (Zv9):
Chromosome 23 (position 1608262)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1576637
GRCz11 23 1585744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAATGTGACGCACTGTAACCTGGAGCACCTGAGCTGTGGACAGACATA[C/A]AATATCTCTGTGCTTTCCATGGATCAAGCGTGCAGCAGTGAATATAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115259 Essential Splice Site 4140 4636 48 55
ENSDART00000136037   None 213 None 4
ENSDART00000143841 Essential Splice Site 112 310 2 5
Genomic Location (Zv9):
Chromosome 23 (position 1605234)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1573609
GRCz11 23 1582716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTCATTCTGTCAGAGCAGCCCTGGCACAAGCTTTCAGATTCAGACAG[G/A]TGCGAACACACTTAAATGAACCACCCATCAGTTAAACTCAGAGCTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link