si:dkeyp-118h9.7

Ensembl ID:
ENSDARG00000075668
ZFIN ID:
ZDB-GENE-091204-477
Description:
LOC555303 protein [Source:UniProtKB/TrEMBL;Acc:A5PLI5]
Human Orthologue:
SACS
Human Description:
spastic ataxia of Charlevoix-Saguenay (sacsin) [Source:HGNC Symbol;Acc:10519]
Mouse Orthologue:
Sacs
Mouse Description:
sacsin Gene [Source:MGI Symbol;Acc:MGI:1354724]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41329 Nonsense Mutation detected in F1 DNA During 2018
sa2509 Nonsense F2 line generated During 2018
sa5780 Nonsense F2 line generated During 2018
sa15453 Nonsense Available for shipment Available now
sa12817 Nonsense Available for shipment Available now
sa27309 Nonsense Mutation detected in F1 DNA During 2018
sa8984 Nonsense Mutation detected in F1 DNA During 2018
sa17059 Nonsense Available for shipment Available now
sa16215 Nonsense Available for shipment Available now
sa21411 Nonsense Available for shipment Available now
sa21412 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 26 605 2 5
ENSDART00000114882 Nonsense 15 4234 1 7
Genomic Location (Zv9):
Chromosome 9 (position 550886)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 565292
GRCz11 9 564925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAATAAGTTTGGTGCCACGTCTCCACCATTCATTGACTACTTGAAA[G/T]AGATTTTAAGAAGGTATCCAGATGGAGGACAAATACTGAAGGTAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2509
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 62 605 3 5
ENSDART00000114882 Nonsense 51 4234 2 7
ENSDART00000111547 Nonsense 62 605 3 5
ENSDART00000114882 Nonsense 51 4234 2 7
Genomic Location (Zv9):
Chromosome 9 (position 552795)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 567785
GRCz11 9 567418
KASP Assay ID:
554-3098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGATGCAGGAGCTTCAACRGTGGTGTTTATTCAYGATGAGAGACATTA[T/G]GAGACGCACAGCCTGTGGACCAAAGAGCTCAGAAAGTACCAAGGTAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5780
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 62 605 3 5
ENSDART00000114882 Nonsense 51 4234 2 7
ENSDART00000111547 Nonsense 62 605 3 5
ENSDART00000114882 Nonsense 51 4234 2 7
Genomic Location (Zv9):
Chromosome 9 (position 552795)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 567785
GRCz11 9 567418
KASP Assay ID:
554-3098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGATGCAGGAGCTTCAACRGTGGTGTTTATTCAYGATGAGAGACATTA[T/G]GAGACGCACAGCCTGTGGACCAAAGAGCTCAGAAAGTACCAAGGTAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 177 605 5 5
ENSDART00000114882 Nonsense 166 4234 4 7
ENSDART00000111547 Nonsense 177 605 5 5
ENSDART00000114882 Nonsense 166 4234 4 7
Genomic Location (Zv9):
Chromosome 9 (position 554825)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 569992
GRCz11 9 569625
KASP Assay ID:
2260-1327.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGACAGAGAGAGCTTGCTGAAATTTACAGATCAGTTTCAGCCCTTT[C/T]GAAATATTGTCAGTCAAGTCAGCWGCAGTACCTGGGAGAAGGTCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 177 605 5 5
ENSDART00000114882 Nonsense 166 4234 4 7
ENSDART00000111547 Nonsense 177 605 5 5
ENSDART00000114882 Nonsense 166 4234 4 7
Genomic Location (Zv9):
Chromosome 9 (position 554825)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 569992
GRCz11 9 569625
KASP Assay ID:
2260-1327.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGACAGAGAGAGCTTGCTGAAATTTACAGATCAGTTTCAGCCCTTT[C/T]GAAATATTGTCAGTCAAGTCAGCWGCAGTACCTGGGAGAAGGTCATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 215 605 5 5
ENSDART00000114882 Nonsense 204 4234 4 7
Genomic Location (Zv9):
Chromosome 9 (position 554940)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 570107
GRCz11 9 569740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGGAACACTCTTCCGGTTCCCCCTGCGTAATGAGGCTTCTGAGATCT[C/A]GGATAACCTGTACGACTCCACTAAAGTTAAACAGCTTTTTGACAGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 593 605 5 5
ENSDART00000114882 Nonsense 582 4234 4 7
Genomic Location (Zv9):
Chromosome 9 (position 556074)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 571241
GRCz11 9 570874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGATGGAACCTTCACTTCTATCAGTACTGGGGWGCAGAACRCTGTTT[T/A]AATTGACAATGAGAAGTTTCCAAGGTACGGTTGGACATCTCTTTTCTACNNNNNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547 Nonsense 597 605 5 5
ENSDART00000114882 Nonsense 586 4234 4 7
Genomic Location (Zv9):
Chromosome 9 (position 556085)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 571252
GRCz11 9 570885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCACTTCTATCAGTACTGGGGWGCAGAACRCTGTTTWAATTGACAAT[G/T]AGAAGTTTCCAAGGTACGGTTGGACATCTCTTTTCTACNNNNNTTCTTTAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547   None 605 None 5
ENSDART00000114882 Nonsense 1583 4234 7 7
Genomic Location (Zv9):
Chromosome 9 (position 559280)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 574447
GRCz11 9 574080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTGAGTGAWCAGATTCAGACTCCTCTGAAAATATCAAGAGAAGTCT[T/A]GAACTCATTTCYTGTCTCAAATGACACACTTCTCCAAAAGCTCAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547   None 605 None 5
ENSDART00000114882 Nonsense 1699 4234 7 7
Genomic Location (Zv9):
Chromosome 9 (position 559627)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 574794
GRCz11 9 574427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATAAAAGCCTCTCTGGCCAGGCTTTTTGCTTTCTCCCACTTTCAATT[G/T]AGACAGGTCTTCCAGTCCATGTCAATGGTACCTTTGCAATCACATCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111547   None 605 None 5
ENSDART00000114882 Nonsense 1833 4234 7 7
Genomic Location (Zv9):
Chromosome 9 (position 560030)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 575197
GRCz11 9 574830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATCGAGGAGAACCCTGCAGTTGGAGGCATTGCCATGAAAGTGATCT[T/A]GAGCTTGGGAGCTTCTTATTCTTCTGTTGTTTCCCTGCCATCATGGGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link