zgc:172291

Ensembl ID:
ENSDARG00000075657
ZFIN ID:
ZDB-GENE-080204-71
Description:
synphilin-1 [Source:RefSeq peptide;Acc:NP_001107108]
Human Orthologue:
SNCAIP
Human Description:
synuclein, alpha interacting protein [Source:HGNC Symbol;Acc:11139]
Mouse Orthologue:
Sncaip
Mouse Description:
synuclein, alpha interacting protein (synphilin) Gene [Source:MGI Symbol;Acc:MGI:1915097]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39521 Nonsense Mutation detected in F1 DNA During 2018
sa30482 Nonsense Mutation detected in F1 DNA During 2018
sa30755 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 342 740 6 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 24793)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 263677
GRCz11 8 114498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGCTTAGCTGTACCCGAGAACACCCGAGCCTCATTCATTACGCTGCT[C/T]GATACGGTCAGGTGAGCGACTGGAGAAAGCAAACACACACTCACTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 457 740 10 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 28715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTATTTCATAGCAAC[C/T]AACTTATTTTTAGATGTATTTCATAGCAACAGGCACATTTTAGATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109721 Nonsense 526 740 13 13
Genomic Location (Zv9):
Chromosome Zv9_NA89 (position 30889)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 269611
GRCz11 8 120432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCATGCGGAAACTGCTGACGAAAGATGCAGCAGAGCGAACCCATCCC[A/T]GAGACACCCACGATGCAGGGGCGGAGTCAGGGGCGGGGCCAGGGGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link