
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
GIGYF1 (1 of 3)
- Ensembl ID:
- ENSDARG00000075647
- Description:
- GRB10 interacting GYF protein 1 [Source:HGNC Symbol;Acc:9126]
- Human Orthologue:
- GIGYF1
- Human Description:
- GRB10 interacting GYF protein 1 [Source:HGNC Symbol;Acc:9126]
- Mouse Orthologue:
- Gigyf1
- Mouse Description:
- GRB10 interacting GYF protein 1 Gene [Source:MGI Symbol;Acc:MGI:1888677]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34046 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa31566 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20912 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34046
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109594 | Essential Splice Site | 55 | 1017 | 2 | 25 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22018665)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20609101 GRCz11 7 20882402 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCGATACGGCCGAGAGGAGATGCTAGCACTTTATGTCAAAGACAACAAG[G/A]TAAGAAAAAGATTTAAACAAATCGGCCTAATTTTTAAGCTTAGGTTATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31566
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109594 | Nonsense | 427 | 1017 | 10 | 25 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22028951)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20619387 GRCz11 7 20892677 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCCGCCACCGGGGGGTGATATTGAGGACGACGAGGGCATGAAGCACCTG[C/T]AACAGGTACTAGAAAACAGATGGGATAATATCTGACTAAAATTCATAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20912
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109594 | Nonsense | 761 | 1017 | 19 | 25 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22047587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20637963 GRCz11 7 20904301 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCCCTCAACCTCCTGGATGTCCAGCAGGAGGCTGACAGAATGCACAAA[C/T]AACAGCACAGAGTCCAGCAGCAGAGGGTAAGACACACATACATACACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: