
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rad9b
- Ensembl ID:
- ENSDARG00000075632
- ZFIN ID:
- ZDB-GENE-040910-3
- Description:
- Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8WGD2]
- Human Orthologue:
- RAD9B
- Human Description:
- RAD9 homolog B (S. pombe) [Source:HGNC Symbol;Acc:21700]
- Mouse Orthologue:
- Rad9b
- Mouse Description:
- RAD9 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2385231]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10079 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10079
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109222 | Nonsense | 59 | 326 | 3 | 9 |
ENSDART00000133519 | Nonsense | 135 | 402 | 5 | 11 |
ENSDART00000141728 | None | 60 | None | 3 |
The following transcripts of ENSDARG00000075632 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 4628249)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 4371280 GRCz11 8 4427986 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAGGAATCACCAAGACCCATAATTTGGGGTATCAGGAGTGTGAAGCTTTA[C/T]AGGCTGTGTTTCCRGCTCACCTCAGTCCAAAYGTCCTGATGGCCCAGTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: